ID: 988655831

View in Genome Browser
Species Human (GRCh38)
Location 5:33210457-33210479
Sequence AAGGATGCAAAGTTGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988655831_988655835 19 Left 988655831 5:33210457-33210479 CCCAGGAGCAACTTTGCATCCTT No data
Right 988655835 5:33210499-33210521 CTCAATATTAACCATCACACTGG 0: 9
1: 53
2: 124
3: 132
4: 259
988655831_988655836 20 Left 988655831 5:33210457-33210479 CCCAGGAGCAACTTTGCATCCTT No data
Right 988655836 5:33210500-33210522 TCAATATTAACCATCACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988655831 Original CRISPR AAGGATGCAAAGTTGCTCCT GGG (reversed) Intergenic
No off target data available for this crispr