ID: 988658375

View in Genome Browser
Species Human (GRCh38)
Location 5:33237424-33237446
Sequence CTTTCTCTACTGCAGTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988658375_988658376 -1 Left 988658375 5:33237424-33237446 CCATGGCACTGCAGTAGAGAAAG No data
Right 988658376 5:33237446-33237468 GAAAGAGTTTTATTGACGCAAGG No data
988658375_988658378 15 Left 988658375 5:33237424-33237446 CCATGGCACTGCAGTAGAGAAAG No data
Right 988658378 5:33237462-33237484 CGCAAGGCCAGTTCTCACATGGG No data
988658375_988658377 14 Left 988658375 5:33237424-33237446 CCATGGCACTGCAGTAGAGAAAG No data
Right 988658377 5:33237461-33237483 ACGCAAGGCCAGTTCTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988658375 Original CRISPR CTTTCTCTACTGCAGTGCCA TGG (reversed) Intergenic
No off target data available for this crispr