ID: 988660150

View in Genome Browser
Species Human (GRCh38)
Location 5:33257657-33257679
Sequence CAGCATATGAATTAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988660150_988660157 25 Left 988660150 5:33257657-33257679 CCATCCTCCTAATTCATATGCTG No data
Right 988660157 5:33257705-33257727 ATATGACCATATTTGAAAATAGG No data
988660150_988660158 26 Left 988660150 5:33257657-33257679 CCATCCTCCTAATTCATATGCTG No data
Right 988660158 5:33257706-33257728 TATGACCATATTTGAAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988660150 Original CRISPR CAGCATATGAATTAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr