ID: 988660832

View in Genome Browser
Species Human (GRCh38)
Location 5:33266415-33266437
Sequence CTGGTAAGAGACAGAATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988660828_988660832 8 Left 988660828 5:33266384-33266406 CCTTCTGATAGAGTTCAGACAAG No data
Right 988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG No data
988660827_988660832 30 Left 988660827 5:33266362-33266384 CCACTATATTCTGCAAACTTAGC No data
Right 988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988660832 Original CRISPR CTGGTAAGAGACAGAATTGT AGG Intergenic
No off target data available for this crispr