ID: 988663366

View in Genome Browser
Species Human (GRCh38)
Location 5:33297995-33298017
Sequence TCTGCTATCGCGCACCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988663364_988663366 -6 Left 988663364 5:33297978-33298000 CCGGCTCTCTTCCTGCTTCTGCT 0: 60
1: 40
2: 25
3: 121
4: 1023
Right 988663366 5:33297995-33298017 TCTGCTATCGCGCACCCTGCTGG No data
988663362_988663366 -4 Left 988663362 5:33297976-33297998 CCCCGGCTCTCTTCCTGCTTCTG No data
Right 988663366 5:33297995-33298017 TCTGCTATCGCGCACCCTGCTGG No data
988663363_988663366 -5 Left 988663363 5:33297977-33297999 CCCGGCTCTCTTCCTGCTTCTGC No data
Right 988663366 5:33297995-33298017 TCTGCTATCGCGCACCCTGCTGG No data
988663359_988663366 13 Left 988663359 5:33297959-33297981 CCAGGGTAGGTGTCTTCCCCCGG No data
Right 988663366 5:33297995-33298017 TCTGCTATCGCGCACCCTGCTGG No data
988663358_988663366 17 Left 988663358 5:33297955-33297977 CCGGCCAGGGTAGGTGTCTTCCC No data
Right 988663366 5:33297995-33298017 TCTGCTATCGCGCACCCTGCTGG No data
988663361_988663366 -3 Left 988663361 5:33297975-33297997 CCCCCGGCTCTCTTCCTGCTTCT No data
Right 988663366 5:33297995-33298017 TCTGCTATCGCGCACCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988663366 Original CRISPR TCTGCTATCGCGCACCCTGC TGG Intergenic
No off target data available for this crispr