ID: 988670682

View in Genome Browser
Species Human (GRCh38)
Location 5:33377860-33377882
Sequence GCAAATGTGTTAGATGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988670682_988670686 29 Left 988670682 5:33377860-33377882 CCTGTACCATCTAACACATTTGC No data
Right 988670686 5:33377912-33377934 TACCTTCACAGAGAACTAAAGGG No data
988670682_988670685 28 Left 988670682 5:33377860-33377882 CCTGTACCATCTAACACATTTGC No data
Right 988670685 5:33377911-33377933 GTACCTTCACAGAGAACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988670682 Original CRISPR GCAAATGTGTTAGATGGTAC AGG (reversed) Intergenic
No off target data available for this crispr