ID: 988670683 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:33377866-33377888 |
Sequence | AGGTATGCAAATGTGTTAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
988670683_988670685 | 22 | Left | 988670683 | 5:33377866-33377888 | CCATCTAACACATTTGCATACCT | No data | ||
Right | 988670685 | 5:33377911-33377933 | GTACCTTCACAGAGAACTAAAGG | No data | ||||
988670683_988670688 | 27 | Left | 988670683 | 5:33377866-33377888 | CCATCTAACACATTTGCATACCT | No data | ||
Right | 988670688 | 5:33377916-33377938 | TTCACAGAGAACTAAAGGGTCGG | No data | ||||
988670683_988670686 | 23 | Left | 988670683 | 5:33377866-33377888 | CCATCTAACACATTTGCATACCT | No data | ||
Right | 988670686 | 5:33377912-33377934 | TACCTTCACAGAGAACTAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
988670683 | Original CRISPR | AGGTATGCAAATGTGTTAGA TGG (reversed) | Intergenic | ||