ID: 988670684

View in Genome Browser
Species Human (GRCh38)
Location 5:33377886-33377908
Sequence TTAAGAAAAATGAAAAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988670684_988670688 7 Left 988670684 5:33377886-33377908 CCTATATTTTTCATTTTTCTTAA No data
Right 988670688 5:33377916-33377938 TTCACAGAGAACTAAAGGGTCGG No data
988670684_988670685 2 Left 988670684 5:33377886-33377908 CCTATATTTTTCATTTTTCTTAA No data
Right 988670685 5:33377911-33377933 GTACCTTCACAGAGAACTAAAGG No data
988670684_988670686 3 Left 988670684 5:33377886-33377908 CCTATATTTTTCATTTTTCTTAA No data
Right 988670686 5:33377912-33377934 TACCTTCACAGAGAACTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988670684 Original CRISPR TTAAGAAAAATGAAAAATAT AGG (reversed) Intergenic