ID: 988670685

View in Genome Browser
Species Human (GRCh38)
Location 5:33377911-33377933
Sequence GTACCTTCACAGAGAACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988670684_988670685 2 Left 988670684 5:33377886-33377908 CCTATATTTTTCATTTTTCTTAA No data
Right 988670685 5:33377911-33377933 GTACCTTCACAGAGAACTAAAGG No data
988670682_988670685 28 Left 988670682 5:33377860-33377882 CCTGTACCATCTAACACATTTGC No data
Right 988670685 5:33377911-33377933 GTACCTTCACAGAGAACTAAAGG No data
988670683_988670685 22 Left 988670683 5:33377866-33377888 CCATCTAACACATTTGCATACCT No data
Right 988670685 5:33377911-33377933 GTACCTTCACAGAGAACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988670685 Original CRISPR GTACCTTCACAGAGAACTAA AGG Intergenic
No off target data available for this crispr