ID: 988670688

View in Genome Browser
Species Human (GRCh38)
Location 5:33377916-33377938
Sequence TTCACAGAGAACTAAAGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988670683_988670688 27 Left 988670683 5:33377866-33377888 CCATCTAACACATTTGCATACCT No data
Right 988670688 5:33377916-33377938 TTCACAGAGAACTAAAGGGTCGG No data
988670684_988670688 7 Left 988670684 5:33377886-33377908 CCTATATTTTTCATTTTTCTTAA No data
Right 988670688 5:33377916-33377938 TTCACAGAGAACTAAAGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988670688 Original CRISPR TTCACAGAGAACTAAAGGGT CGG Intergenic