ID: 988676726

View in Genome Browser
Species Human (GRCh38)
Location 5:33440684-33440706
Sequence GGAACAATCATGGACCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 111}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988676726_988676732 2 Left 988676726 5:33440684-33440706 CCGGGAAGGTCCATGATTGTTCC 0: 1
1: 0
2: 3
3: 7
4: 111
Right 988676732 5:33440709-33440731 ATAAAGTCAGAAGGGAGGAAAGG 0: 1
1: 0
2: 9
3: 96
4: 1035
988676726_988676730 -3 Left 988676726 5:33440684-33440706 CCGGGAAGGTCCATGATTGTTCC 0: 1
1: 0
2: 3
3: 7
4: 111
Right 988676730 5:33440704-33440726 TCCACATAAAGTCAGAAGGGAGG 0: 1
1: 0
2: 2
3: 9
4: 197
988676726_988676736 30 Left 988676726 5:33440684-33440706 CCGGGAAGGTCCATGATTGTTCC 0: 1
1: 0
2: 3
3: 7
4: 111
Right 988676736 5:33440737-33440759 GCGCATTGGGGACTTGACTCTGG 0: 1
1: 0
2: 0
3: 3
4: 42
988676726_988676734 17 Left 988676726 5:33440684-33440706 CCGGGAAGGTCCATGATTGTTCC 0: 1
1: 0
2: 3
3: 7
4: 111
Right 988676734 5:33440724-33440746 AGGAAAGGCGCACGCGCATTGGG 0: 1
1: 0
2: 1
3: 0
4: 25
988676726_988676733 16 Left 988676726 5:33440684-33440706 CCGGGAAGGTCCATGATTGTTCC 0: 1
1: 0
2: 3
3: 7
4: 111
Right 988676733 5:33440723-33440745 GAGGAAAGGCGCACGCGCATTGG 0: 1
1: 0
2: 0
3: 2
4: 31
988676726_988676729 -6 Left 988676726 5:33440684-33440706 CCGGGAAGGTCCATGATTGTTCC 0: 1
1: 0
2: 3
3: 7
4: 111
Right 988676729 5:33440701-33440723 TGTTCCACATAAAGTCAGAAGGG 0: 1
1: 0
2: 1
3: 15
4: 190
988676726_988676735 18 Left 988676726 5:33440684-33440706 CCGGGAAGGTCCATGATTGTTCC 0: 1
1: 0
2: 3
3: 7
4: 111
Right 988676735 5:33440725-33440747 GGAAAGGCGCACGCGCATTGGGG 0: 1
1: 0
2: 0
3: 1
4: 25
988676726_988676728 -7 Left 988676726 5:33440684-33440706 CCGGGAAGGTCCATGATTGTTCC 0: 1
1: 0
2: 3
3: 7
4: 111
Right 988676728 5:33440700-33440722 TTGTTCCACATAAAGTCAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988676726 Original CRISPR GGAACAATCATGGACCTTCC CGG (reversed) Intronic