ID: 988676727

View in Genome Browser
Species Human (GRCh38)
Location 5:33440694-33440716
Sequence GACTTTATGTGGAACAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988676727_988676735 8 Left 988676727 5:33440694-33440716 CCATGATTGTTCCACATAAAGTC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 988676735 5:33440725-33440747 GGAAAGGCGCACGCGCATTGGGG 0: 1
1: 0
2: 0
3: 1
4: 25
988676727_988676734 7 Left 988676727 5:33440694-33440716 CCATGATTGTTCCACATAAAGTC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 988676734 5:33440724-33440746 AGGAAAGGCGCACGCGCATTGGG 0: 1
1: 0
2: 1
3: 0
4: 25
988676727_988676733 6 Left 988676727 5:33440694-33440716 CCATGATTGTTCCACATAAAGTC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 988676733 5:33440723-33440745 GAGGAAAGGCGCACGCGCATTGG 0: 1
1: 0
2: 0
3: 2
4: 31
988676727_988676732 -8 Left 988676727 5:33440694-33440716 CCATGATTGTTCCACATAAAGTC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 988676732 5:33440709-33440731 ATAAAGTCAGAAGGGAGGAAAGG 0: 1
1: 0
2: 9
3: 96
4: 1035
988676727_988676736 20 Left 988676727 5:33440694-33440716 CCATGATTGTTCCACATAAAGTC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 988676736 5:33440737-33440759 GCGCATTGGGGACTTGACTCTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988676727 Original CRISPR GACTTTATGTGGAACAATCA TGG (reversed) Intronic