ID: 988676731

View in Genome Browser
Species Human (GRCh38)
Location 5:33440705-33440727
Sequence TCCTCCCTTCTGACTTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988676731_988676734 -4 Left 988676731 5:33440705-33440727 CCACATAAAGTCAGAAGGGAGGA 0: 1
1: 0
2: 3
3: 29
4: 240
Right 988676734 5:33440724-33440746 AGGAAAGGCGCACGCGCATTGGG 0: 1
1: 0
2: 1
3: 0
4: 25
988676731_988676733 -5 Left 988676731 5:33440705-33440727 CCACATAAAGTCAGAAGGGAGGA 0: 1
1: 0
2: 3
3: 29
4: 240
Right 988676733 5:33440723-33440745 GAGGAAAGGCGCACGCGCATTGG 0: 1
1: 0
2: 0
3: 2
4: 31
988676731_988676735 -3 Left 988676731 5:33440705-33440727 CCACATAAAGTCAGAAGGGAGGA 0: 1
1: 0
2: 3
3: 29
4: 240
Right 988676735 5:33440725-33440747 GGAAAGGCGCACGCGCATTGGGG 0: 1
1: 0
2: 0
3: 1
4: 25
988676731_988676737 27 Left 988676731 5:33440705-33440727 CCACATAAAGTCAGAAGGGAGGA 0: 1
1: 0
2: 3
3: 29
4: 240
Right 988676737 5:33440755-33440777 TCTGGAAAGCGTCCAGACCAAGG 0: 1
1: 0
2: 0
3: 10
4: 99
988676731_988676736 9 Left 988676731 5:33440705-33440727 CCACATAAAGTCAGAAGGGAGGA 0: 1
1: 0
2: 3
3: 29
4: 240
Right 988676736 5:33440737-33440759 GCGCATTGGGGACTTGACTCTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988676731 Original CRISPR TCCTCCCTTCTGACTTTATG TGG (reversed) Intronic