ID: 988676733

View in Genome Browser
Species Human (GRCh38)
Location 5:33440723-33440745
Sequence GAGGAAAGGCGCACGCGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988676727_988676733 6 Left 988676727 5:33440694-33440716 CCATGATTGTTCCACATAAAGTC 0: 1
1: 0
2: 0
3: 15
4: 120
Right 988676733 5:33440723-33440745 GAGGAAAGGCGCACGCGCATTGG 0: 1
1: 0
2: 0
3: 2
4: 31
988676731_988676733 -5 Left 988676731 5:33440705-33440727 CCACATAAAGTCAGAAGGGAGGA 0: 1
1: 0
2: 3
3: 29
4: 240
Right 988676733 5:33440723-33440745 GAGGAAAGGCGCACGCGCATTGG 0: 1
1: 0
2: 0
3: 2
4: 31
988676726_988676733 16 Left 988676726 5:33440684-33440706 CCGGGAAGGTCCATGATTGTTCC 0: 1
1: 0
2: 3
3: 7
4: 111
Right 988676733 5:33440723-33440745 GAGGAAAGGCGCACGCGCATTGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988676733 Original CRISPR GAGGAAAGGCGCACGCGCAT TGG Intronic