ID: 988676811

View in Genome Browser
Species Human (GRCh38)
Location 5:33441104-33441126
Sequence CAGCAGTCCTTCAGGGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988676807_988676811 -3 Left 988676807 5:33441084-33441106 CCAATGTTTGAGGAGAAGGCCAG 0: 1
1: 0
2: 0
3: 18
4: 144
Right 988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG 0: 1
1: 0
2: 2
3: 24
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988676811 Original CRISPR CAGCAGTCCTTCAGGGAAGA TGG Exonic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
902205758 1:14867032-14867054 CAGCAGTCCATCAGGGAGGCAGG - Intronic
903011355 1:20332875-20332897 CAGCCGTTCTCCAGGGAAGAGGG - Exonic
905807447 1:40887111-40887133 AAGCAGGTCTGCAGGGAAGAGGG + Intergenic
905945991 1:41901882-41901904 TAACAGACCTTAAGGGAAGAAGG - Intronic
913340962 1:117757903-117757925 CAGGAGTCCTTCAGAGGTGATGG + Intergenic
914407473 1:147390047-147390069 CAGCAGTGCTTAGGGGAAGAGGG - Intergenic
914741721 1:150471376-150471398 GAAGAGTCCATCAGGGAAGATGG - Exonic
914948370 1:152087006-152087028 CAGCAGTCCCACAGAGAGGAAGG - Exonic
916455984 1:164971422-164971444 CAGCAGAGCTGCAGGGCAGAAGG + Intergenic
916499415 1:165374017-165374039 CAGCAGCCCTCCGGGGAACAAGG - Intergenic
917125787 1:171686321-171686343 CAGCAGTTCTCCAGAGAAGGGGG + Intergenic
917130100 1:171732669-171732691 CAGCAGTACTTAAAGGAAAATGG + Intronic
917451884 1:175154060-175154082 CACTAGCCCTTCATGGAAGACGG + Intergenic
918012681 1:180602580-180602602 CAGCAGTGCTTCAGCCAACAAGG + Intergenic
919120365 1:193332837-193332859 AAGCTGTCCTTCAGGAATGAAGG - Intergenic
920207778 1:204305444-204305466 CTGCAATCCTGTAGGGAAGATGG - Intronic
920271418 1:204767443-204767465 CATAAGCCCATCAGGGAAGAAGG - Intergenic
920408855 1:205742004-205742026 CAGTAGTCACTCAAGGAAGAGGG + Intronic
920516558 1:206588630-206588652 CAGCATTCCTTCTGGGATCAGGG - Intronic
920789187 1:209072323-209072345 CAGCCCTCTTTCAGGGAAGCAGG + Intergenic
921807705 1:219474889-219474911 CATCATTCCTTCTGAGAAGATGG + Intergenic
921887661 1:220322665-220322687 GAGCAGTCCTTCCAGGAAGAGGG - Intergenic
923373606 1:233337671-233337693 CAGCACACCTGCAGGGAACAAGG - Intronic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
923986390 1:239387039-239387061 CAGCAGCGCTTCTGGGAAGACGG + Intronic
924492001 1:244547142-244547164 CAGAAGTCTTACAGGCAAGAAGG + Intronic
1063237658 10:4135125-4135147 GAGCAGTGCTTCAGCTAAGAAGG + Intergenic
1063835203 10:10004316-10004338 CAGCAGAACCTCTGGGAAGAGGG - Intergenic
1064186434 10:13166108-13166130 CAGGAGTGCTTCAGAGGAGAGGG + Intronic
1064586315 10:16842850-16842872 CAGGAGTCCTCCTGGGATGAAGG - Intronic
1065875711 10:29995646-29995668 CAGAAATTCTTCAGGGAAGTAGG - Intergenic
1067142412 10:43668376-43668398 CCTCAGCCTTTCAGGGAAGATGG + Intergenic
1067211189 10:44261404-44261426 CTCCAGTGCTTCAGTGAAGAGGG - Intergenic
1067324006 10:45249151-45249173 CAGGAGTCCTCCTGGGATGAAGG - Intergenic
1070275345 10:75000756-75000778 GGGCAGTCCTTCATGGAACAAGG + Intronic
1070692034 10:78534025-78534047 CAGCAGTGTTTCTGGGAAGGTGG - Intergenic
1070931427 10:80263857-80263879 AAGCAGCCCTTCATGGAAGCTGG + Intergenic
1070974511 10:80595607-80595629 CAGCAGTCACTCAGGTAGGAAGG - Intronic
1071100365 10:82029743-82029765 CAGGAGCCCTGCAGTGAAGATGG + Intronic
1071461142 10:85897406-85897428 CAGGAAACCTCCAGGGAAGATGG + Intronic
1071730433 10:88243292-88243314 CAGCAGAGCTTCAGGGAAAATGG - Intergenic
1072665280 10:97388300-97388322 CACCAGGCCTTCCGGGAAGCAGG + Exonic
1075010753 10:118868007-118868029 CTGATGTCCTTCAAGGAAGAAGG + Intergenic
1076289595 10:129334872-129334894 CAGGAGCCCATCAGGCAAGATGG - Intergenic
1076783691 10:132738593-132738615 CAACAGACTTTCTGGGAAGAAGG - Intronic
1076806829 10:132862945-132862967 TAGGAGGCCTTCAGGCAAGAGGG + Intronic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1077938926 11:6818907-6818929 CTGCAGCCCTTCAGGGAACCTGG + Intergenic
1078145767 11:8721045-8721067 GGCCAGGCCTTCAGGGAAGAGGG - Intronic
1078147085 11:8729450-8729472 CAGGAGGCCTTCAGGAGAGAAGG + Intronic
1078524324 11:12089126-12089148 AAGCAGTGCTGCAAGGAAGATGG - Intergenic
1079257675 11:18846691-18846713 CAGAAATCCTTCAAGGTAGAAGG + Intergenic
1080179436 11:29406282-29406304 CAGCAGTCCTATGGGGAAGAGGG + Intergenic
1089434214 11:118449800-118449822 CATCTTTCCTTCTGGGAAGATGG - Intronic
1092170722 12:6372441-6372463 CAGCAGCCCTTCAAGAAGGAGGG + Intronic
1092907706 12:13116985-13117007 CAGCTGTCCTCTTGGGAAGAGGG - Intronic
1092976509 12:13750196-13750218 TAGCAGTCCTACAGGGAATAAGG - Intronic
1093113760 12:15184349-15184371 GAGCAGTCTTGCAGGGAAGAAGG + Intronic
1094299033 12:28940075-28940097 GAAAAGTCCTTCAGTGAAGAAGG - Intergenic
1094452459 12:30597081-30597103 CAGCAGGCATTGAGTGAAGAAGG + Intergenic
1094801737 12:34045231-34045253 TAGCAGTCATTAAGGAAAGAAGG + Intergenic
1095114871 12:38341138-38341160 TAGCAGTCATTAAGGAAAGAAGG + Intergenic
1095716484 12:45351659-45351681 CAGAAGTCCTTCTAGGAATAGGG + Intronic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099423191 12:82489736-82489758 AAGCTGTCCTTCAGGAATGAAGG + Intergenic
1103733100 12:123041759-123041781 CAGAGGCCCTTCAGGGAGGAAGG + Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105751844 13:23427967-23427989 AAGGAATCCTTCAGGGAAGAGGG - Intronic
1106976238 13:35219872-35219894 CTGCCCTCCTTCATGGAAGAAGG - Intronic
1108257720 13:48626970-48626992 TAGGAGTCCTTCCGGTAAGAGGG - Intergenic
1108459673 13:50652548-50652570 CAGCAGGCTTCCAGGGAGGATGG + Intronic
1108699210 13:52929414-52929436 CTGAAGTCCATCAGGGAACAGGG - Intergenic
1110904201 13:80864712-80864734 CAGTATTTCTTCAAGGAAGATGG - Intergenic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1113014425 13:105811920-105811942 CAACAGTCCTGCAGACAAGAAGG + Intergenic
1116063023 14:39948028-39948050 TAGCAGTCCTTTAAAGAAGAAGG - Intergenic
1117415812 14:55494531-55494553 CAGCAATTGTTCAGGGAATAAGG + Intergenic
1117953335 14:61104032-61104054 TAACAGTCCTGCAGGGAGGAGGG - Intergenic
1119265762 14:73262591-73262613 CAGCAGTCCTGCAGGCGAGCAGG + Exonic
1119707257 14:76790767-76790789 CTACAGTCCTACAGGGATGAAGG + Exonic
1119949189 14:78727188-78727210 CAGCAGTCATTGAGAGAAGTGGG + Intronic
1119961851 14:78867565-78867587 CATGACTGCTTCAGGGAAGAAGG - Intronic
1121334645 14:93069796-93069818 CACCAGACTTTCAGGGAAGGAGG - Intronic
1121610954 14:95278945-95278967 GTGCAGTCCTTCAAGGAACAGGG - Intronic
1122583235 14:102784912-102784934 TGGCTGTCCTTCAGGGGAGAGGG + Intronic
1123005904 14:105323737-105323759 CTGCAGTGATCCAGGGAAGATGG + Intronic
1123459677 15:20458410-20458432 CTGCAGGCCTCCAGAGAAGATGG + Intergenic
1123658385 15:22542010-22542032 CTGCAGGCCTCCAGAGAAGATGG - Intergenic
1124154971 15:27217853-27217875 CAGCCGTCCCGCTGGGAAGAAGG - Intronic
1124265906 15:28234247-28234269 CTGCAGGCCTCCAGAGAAGATGG + Exonic
1124312250 15:28636502-28636524 CTGCAGGCCTCCAGAGAAGATGG - Intergenic
1128021422 15:64394094-64394116 CAGCAGTGCTTCAAAAAAGATGG + Exonic
1128250127 15:66158188-66158210 CAGCAGTGCTTCTGGCTAGAGGG - Intronic
1128515123 15:68337318-68337340 CATCAGGCCTTCAGGGAGGCTGG - Intronic
1129112240 15:73344197-73344219 CAGCTGACCCTCAGGGAGGATGG - Intronic
1130521963 15:84669425-84669447 GAACAGTCCTTCAGCTAAGAAGG - Intergenic
1132546961 16:537666-537688 CAGGAGTCCCTCACGGGAGACGG - Intronic
1133212326 16:4270644-4270666 CAGCAGTCCCCCAGGGTAGCTGG - Intronic
1133888503 16:9854827-9854849 CAGCAGTGCTTCCAGGAATAAGG + Intronic
1135600010 16:23775026-23775048 CAGAAATCCTTCAGCGCAGATGG + Intergenic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136608666 16:31353201-31353223 CAGCTGTCCTGGTGGGAAGAGGG - Intergenic
1136995095 16:35183580-35183602 CAGCAGACCCTGAGAGAAGAAGG + Intergenic
1137297670 16:47111907-47111929 CAGCACTCCACCAGGGAAAAGGG + Intronic
1138096393 16:54215213-54215235 CCGCTTTCCTTCAGGGAAGCAGG + Intergenic
1139588449 16:67919422-67919444 CAGCAGGCTGGCAGGGAAGAAGG - Intronic
1140777171 16:78260230-78260252 CAGCAGTGTTACTGGGAAGAGGG + Intronic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1143265101 17:5630698-5630720 CAGCTGTCCCCCAGGGAAGTAGG + Intergenic
1143417170 17:6758656-6758678 CATCTCTCCTGCAGGGAAGATGG - Intronic
1143417217 17:6758847-6758869 CATCTCTCCTGCAGGGAAGATGG - Intronic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1145959996 17:28881647-28881669 CAGCAGTCCCACAGGGGACATGG + Intronic
1148173568 17:45544968-45544990 TAGCATTACTTCAGGGATGAGGG + Intergenic
1148247256 17:46041559-46041581 CACCACTACTTCAAGGAAGAAGG + Intronic
1148275702 17:46300481-46300503 TAGCATTACTTCAGGGATGAGGG - Intronic
1148297812 17:46518057-46518079 TAGCATTACTTCAGGGATGAGGG - Intronic
1148362360 17:47022538-47022560 TAGCATTACTTCAGGGATGAGGG - Intronic
1150047606 17:61928526-61928548 CGGCACTTCTTCTGGGAAGAGGG + Intergenic
1150404774 17:64891883-64891905 TAGCATTACTTCAGGGATGAGGG + Intronic
1150508790 17:65726412-65726434 CAGCAGAGCTTCATGGAGGAGGG + Intronic
1150783857 17:68146819-68146841 CAGCATTACCTCAGGGATGAGGG + Intergenic
1151260784 17:72914494-72914516 CACCAGTCCTTGATGGAAAATGG - Intronic
1151952405 17:77362408-77362430 CAGCAGTCCTGCAAGCCAGATGG - Intronic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1155228358 18:23750033-23750055 ATGCAGTCATTCAGGGAAGCAGG - Intronic
1158519931 18:58163432-58163454 CTGCAGCGCTTCAGGGAACAGGG + Intronic
1159778241 18:72628659-72628681 CAACAGTCCTTCATTGAAGGGGG + Intronic
1161808842 19:6459929-6459951 CAGAGTTCCTTCTGGGAAGACGG + Intronic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1166337050 19:42114605-42114627 TAGCTGTCCTTCACGGAACATGG - Intronic
925178196 2:1799500-1799522 CAGCAGGCCTTCACTGCAGAAGG + Intronic
925508479 2:4597157-4597179 CAGCTATCCTTCATGGGAGAAGG - Intergenic
925735701 2:6961772-6961794 CAGGAATACTTCATGGAAGAAGG - Intronic
925886995 2:8401779-8401801 CACCAGGCCTGCAGGGAGGAAGG + Intergenic
926186834 2:10697253-10697275 CAGCAGTGCTTCTTAGAAGATGG - Intergenic
926732901 2:16050616-16050638 CAGCAGATCTTCAGGGCAGGGGG - Intergenic
926819910 2:16840647-16840669 CAGCAGTACCTGGGGGAAGAAGG - Intergenic
926891064 2:17639125-17639147 CAGTTGCCCTTCAGGGGAGAGGG + Intronic
927487724 2:23500238-23500260 CAGGAGGGCTTCATGGAAGAGGG + Intronic
927855227 2:26523581-26523603 CCTGAGTCCTTCAGAGAAGAGGG + Intronic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
932003221 2:67903794-67903816 CAGCAGTACTGCAGGGTACAGGG + Intergenic
932396842 2:71454440-71454462 GACCAGACCTTCAGGGGAGAAGG - Intronic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
932837116 2:75048178-75048200 CAGCTGCACTTCTGGGAAGAGGG - Exonic
933731057 2:85456534-85456556 CAGGAGACCATCAAGGAAGATGG - Intergenic
934656383 2:96118571-96118593 CAGCATCCCTTGAAGGAAGATGG - Intergenic
937314496 2:120922416-120922438 CAGCAGGCCTTCAGTGAGTAGGG - Intronic
937919778 2:127120929-127120951 CAGCAGTCCTACAGAACAGAAGG - Intergenic
938068666 2:128295123-128295145 CAGTAGCCCTTCAGGACAGAGGG - Intronic
938074064 2:128322635-128322657 CTTCAGTCCTTAGGGGAAGAGGG + Intergenic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
940945686 2:159615585-159615607 CGTCAGTCCGACAGGGAAGAGGG + Intronic
942189706 2:173457596-173457618 CAGGAGTCCCACGGGGAAGACGG - Intergenic
942541701 2:177021796-177021818 CAGCAGTCCTAAAGGAAACAGGG - Intergenic
943518241 2:188913243-188913265 AAGTAGTCATTTAGGGAAGAGGG - Intergenic
945007862 2:205428458-205428480 CAGCAATCCATCCTGGAAGAAGG + Intronic
946035417 2:216738367-216738389 CAGCAGTCCTTCATGCCTGAGGG + Intergenic
947116250 2:226774288-226774310 TAACTGTCCTTCAAGGAAGAGGG + Intronic
947477783 2:230466676-230466698 AAGCAGTTCTTCAGGGAAGCAGG + Intronic
947690986 2:232135523-232135545 TAGCTGTTTTTCAGGGAAGAAGG + Intronic
947709407 2:232303094-232303116 CAGAAGACTTTCTGGGAAGATGG - Intronic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
948421301 2:237862026-237862048 CAGCATTCCCTGAGTGAAGATGG - Intronic
1169058260 20:2641537-2641559 CACCTGTCCTTTAGGGAAGCTGG + Exonic
1171238378 20:23546177-23546199 CAGCCGTCCTTCATGGAGCAAGG - Intergenic
1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG + Intergenic
1178277706 21:31254023-31254045 TCTCAGTCCTTCTGGGAAGAAGG + Intronic
1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG + Intergenic
1180889411 22:19275292-19275314 CAGCAGGCCCTCAGGCAAGGGGG + Intronic
1180922106 22:19526226-19526248 CAGCAGTCATCCCAGGAAGATGG - Intronic
1181987256 22:26808816-26808838 AAGCAGGCTTTCATGGAAGAGGG - Intergenic
1182079421 22:27518562-27518584 CAGCAGCCTTCCAGGCAAGAAGG + Intergenic
1182248916 22:28983970-28983992 CAGCAGCCCTTCAGGAAACTGGG - Intronic
1182473976 22:30565858-30565880 CAGCAGTGCTGAAGGGAGGATGG - Intronic
1182624221 22:31634236-31634258 CAGAAGCCCCTCAAGGAAGATGG + Intronic
949228902 3:1727285-1727307 CAGTTTTGCTTCAGGGAAGAAGG - Intergenic
950633405 3:14298975-14298997 CAGCAGATCTACAGGGGAGATGG - Intergenic
951366226 3:21786365-21786387 CAGTACTCCTTTAGGGAAGTCGG + Intronic
953016616 3:39082928-39082950 CATCAGTCTTTCAGGGATGTTGG + Intronic
954683064 3:52356247-52356269 CAGAAGTCCTTCCAGGAAGGAGG + Intronic
955226338 3:57063436-57063458 CCGCAGTCATTCAGGTGAGAGGG + Intronic
956468353 3:69541173-69541195 CAGCAGTCTTTCCGGGAAGCTGG - Intronic
956541095 3:70340558-70340580 CTGCCTTCCTTCAGGGAACATGG + Intergenic
958974974 3:100657409-100657431 CAGCAGTACTTCAGGTAACTGGG - Intronic
960279617 3:115766643-115766665 AAGCTGTCCTGCAGGGAAGGAGG + Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
962036387 3:131656088-131656110 AAGCACTCCTTCAGGAATGAGGG - Intronic
962367768 3:134797167-134797189 CAGCAGTCCCTGAGGGAAGCAGG - Intronic
962936806 3:140089084-140089106 TAGCAGGTCTTCAGGAAAGAGGG - Intronic
966318164 3:178672073-178672095 CTACAGTCCTTCAGAGAAAAAGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968585358 4:1413827-1413849 CCGCAGCCTTTCAGGGAGGAGGG + Intergenic
969683487 4:8656263-8656285 CAGGAGTCCTGCAGGGGACACGG + Intergenic
969693161 4:8718385-8718407 CAGCAGTCCTACAGAGGAGAGGG + Intergenic
970899221 4:21139352-21139374 CAGAAGTACTTCAGGTAAAATGG + Intronic
972159165 4:36201417-36201439 CAGAATTCCTTCAGGAAAAAAGG + Intronic
972935651 4:44131768-44131790 CACCAGCCCTTCAGGGAAAATGG - Intergenic
973975978 4:56262935-56262957 CAGCTGGCCCTAAGGGAAGAGGG + Intronic
976055089 4:81055141-81055163 TATCATTCCTTCAAGGAAGACGG - Exonic
976592089 4:86859327-86859349 CAGCAGGCCTTCTGGGCAGCAGG - Intergenic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
978122506 4:105097519-105097541 CAGAAGTCCTTAAGAGAAAAGGG + Intergenic
979239350 4:118434750-118434772 CAGCTGTTCTGCAGGGAAGGAGG + Intergenic
980232063 4:130057797-130057819 CAGGACTCCTTTAGGTAAGATGG - Intergenic
985383392 4:189419485-189419507 GAGGAGCACTTCAGGGAAGACGG + Intergenic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985900192 5:2782777-2782799 CAGCAGTATTTCTGGGATGAGGG - Intergenic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
990627410 5:57630231-57630253 TAGTAGTCATTCAGGGAAGCTGG + Intergenic
991019391 5:61964199-61964221 CTGCAGCCCTTTAAGGAAGATGG - Intergenic
993593983 5:89829652-89829674 CAGCAGGTCTTCAGTGATGAGGG - Intergenic
994429488 5:99639291-99639313 TACCTTTCCTTCAGGGAAGAAGG + Intergenic
994923842 5:106087976-106087998 CAACAGACCTTCATGTAAGAAGG + Intergenic
995519967 5:112993752-112993774 TGGCAGTCCTTCAGGGAAAAGGG - Intronic
996124162 5:119706197-119706219 CAACAGACTTTCAGGGAAGTGGG + Intergenic
997109162 5:131055690-131055712 AAGCAGTCCTTCATGAATGAGGG + Intergenic
997354676 5:133254647-133254669 CCGCAGTCATACAGTGAAGACGG + Intronic
997639425 5:135438950-135438972 CTTAAGGCCTTCAGGGAAGATGG + Intergenic
998031274 5:138870672-138870694 CTGCTGTCCTTCAGGGCTGATGG + Exonic
1000130261 5:158290416-158290438 CAGCATTGCTTTAGGGAAGGGGG + Intergenic
1000618752 5:163459786-163459808 CAACAGTCGTTCAGGGAAACGGG + Intronic
1003202744 6:3977282-3977304 AAGCAGTGCTTCTGGCAAGATGG + Intergenic
1003422537 6:5971322-5971344 CAGCAGTCCATAATGGAACATGG - Intergenic
1004243554 6:13951255-13951277 CAGAAGACCTTCAAGGAACAGGG + Intronic
1005581289 6:27237826-27237848 CTGCACTCCCGCAGGGAAGAAGG + Intergenic
1006170977 6:32092422-32092444 GAGAAGTGCTTCTGGGAAGAGGG + Intronic
1006397210 6:33795315-33795337 CAGCAGTTCTCCAGGGAGGCGGG - Intronic
1007378018 6:41469533-41469555 CTGCAGTCACTCAGGGAGGAGGG + Intergenic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1012549914 6:100456681-100456703 AAGCAGACTTTAAGGGAAGAGGG - Intronic
1013307465 6:108862841-108862863 CAGCAGTCAGTCAGGGAACAGGG + Intronic
1014644782 6:123959385-123959407 CAGGAGTCCTTCAGGCAACTAGG + Intronic
1015859953 6:137665492-137665514 CAGTAATCCTTCAAAGAAGAAGG + Intergenic
1015891109 6:137970479-137970501 CCGCAGTCCTCCAGGGGAGGGGG + Intergenic
1018248339 6:161843316-161843338 CAGCTGTCTCTCAGAGAAGATGG - Intronic
1019383418 7:740149-740171 CAACACTCCTTAAGGGAAGCGGG - Intronic
1019625320 7:2012946-2012968 CAGCAGCTGTTCAGGGAAGATGG - Intronic
1021719422 7:23491227-23491249 CAGAAGTCCTTCAGGGGATCAGG - Intergenic
1022834799 7:34103177-34103199 GAGCAGTACTTCTGGGAATAGGG + Intronic
1023039708 7:36161412-36161434 CAGCATTCGGTCAGGGATGAAGG + Intronic
1023098457 7:36687818-36687840 CAGGATTCCTTGAGGGAAGGTGG + Intronic
1023482143 7:40645527-40645549 CCACAGTGCTTCAGGGAAGTAGG - Intronic
1024996720 7:55278170-55278192 CACCAGCCCTTCAGGAGAGATGG + Intergenic
1026362530 7:69615822-69615844 CAGGAGTGCTTCTTGGAAGATGG - Intronic
1030094371 7:105885127-105885149 CAGCTGTCCGTCAGGCCAGAAGG + Intronic
1033448890 7:141445350-141445372 AAACAGTCCTCCAGGCAAGATGG - Intronic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1039376662 8:37041426-37041448 ATGAAGTCCATCAGGGAAGAAGG + Intergenic
1039816342 8:41097903-41097925 CAGCAATCGTTCTGGGAAGTGGG + Intergenic
1040625911 8:49149842-49149864 CAGCAATGCTCAAGGGAAGAGGG + Intergenic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1042202794 8:66297545-66297567 AAGCATTTCTTCTGGGAAGATGG - Intergenic
1042762635 8:72287289-72287311 TAGCAGACCTGCAGGTAAGACGG - Intergenic
1043107700 8:76135890-76135912 CAGCAGCCCCCCAGGGGAGATGG + Intergenic
1043113301 8:76215821-76215843 CAGCTGTACTCCAGGGAAGATGG - Intergenic
1043528279 8:81120511-81120533 CTGCAGTCCAGCAGGAAAGAAGG - Intergenic
1045683350 8:104686302-104686324 CAGCCTTCCTTCAGGAAGGAAGG - Intronic
1046558358 8:115805748-115805770 CAGCAATATTTCAGGGAAGGTGG - Intronic
1047768745 8:128013067-128013089 CAGGATGGCTTCAGGGAAGAAGG - Intergenic
1047859348 8:128947474-128947496 CACCAATCCTTCAGGTAAAAGGG - Intergenic
1048434015 8:134399086-134399108 CAGCCTTCCTTCACAGAAGAAGG + Intergenic
1049703028 8:144023627-144023649 AAGAAGTTCCTCAGGGAAGAGGG - Intronic
1050383684 9:5060742-5060764 CATCAGTGATTCATGGAAGAAGG - Intronic
1051363282 9:16301339-16301361 CAAGAGGCCTTCAGGCAAGAAGG + Intergenic
1051531352 9:18107496-18107518 TGGCAGTACTTCAGGGAATAAGG + Intergenic
1051750590 9:20337339-20337361 CATCAGTCCTGCAAGGAAGAAGG - Intergenic
1052849325 9:33367033-33367055 CAGCATTTCTTCAGGCAAGGGGG + Intronic
1053163278 9:35828414-35828436 CAGATGTCTTTGAGGGAAGAGGG + Intronic
1054879587 9:70130908-70130930 CAGCTGACATTCAAGGAAGAGGG + Intronic
1055914789 9:81389916-81389938 CACCAGCCCTAGAGGGAAGAGGG + Intergenic
1056816780 9:89807615-89807637 AAGCAGTCCATAAGAGAAGAAGG - Intergenic
1057765148 9:97910120-97910142 CAGCAGTCTTGCAAGGAAGCAGG - Exonic
1058319694 9:103613736-103613758 AAGCAGTCCTTCAGAAATGAGGG - Intergenic
1060218525 9:121752524-121752546 CAGGAAGGCTTCAGGGAAGAAGG + Intronic
1062151092 9:135019432-135019454 CAGGAGAGCTCCAGGGAAGACGG + Intergenic
1062566679 9:137166797-137166819 CAGGAGTCCCGCAGGGAACAGGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186844489 X:13517242-13517264 CAGGAGACCATGAGGGAAGAGGG + Intergenic
1189308364 X:40004148-40004170 AAGCAGTCCCTGAGGGAGGAAGG + Intergenic
1189617290 X:42796810-42796832 CAGCAGCCCTTATGTGAAGATGG - Intergenic
1190860671 X:54341821-54341843 AAGCAATCTTTCAGGGATGATGG + Intronic
1192077605 X:68016418-68016440 CAGCAATTGTTCAGGGAATAAGG + Intergenic
1192679568 X:73237892-73237914 CAGGAGTCCTCCAGGGATGATGG - Intergenic
1195146756 X:102026262-102026284 CAGCAGGGCTTCAGGGATGTGGG - Intergenic
1196499917 X:116367996-116368018 CAGCACTGCTACAGAGAAGAGGG + Intergenic
1197586662 X:128356325-128356347 CAGCTGGCCTTCTGAGAAGAGGG - Intergenic
1198623789 X:138544745-138544767 CAGCAATCATTTAGGGAGGAAGG + Intergenic
1199867921 X:151870953-151870975 CAGCAGTTCTTCAGAGAACAAGG + Intergenic