ID: 988676827

View in Genome Browser
Species Human (GRCh38)
Location 5:33441171-33441193
Sequence CACCCACTAGAGTCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988676827_988676838 19 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676838 5:33441213-33441235 GGGAGCGGGGGGCAGGAAGCAGG 0: 1
1: 1
2: 4
3: 148
4: 1410
988676827_988676841 30 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676841 5:33441224-33441246 GCAGGAAGCAGGAAGCGGCCGGG 0: 1
1: 0
2: 3
3: 61
4: 534
988676827_988676836 8 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676836 5:33441202-33441224 ACGCTCGCGGCGGGAGCGGGGGG 0: 1
1: 0
2: 1
3: 10
4: 123
988676827_988676833 5 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676833 5:33441199-33441221 GCTACGCTCGCGGCGGGAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
988676827_988676837 12 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676837 5:33441206-33441228 TCGCGGCGGGAGCGGGGGGCAGG 0: 1
1: 0
2: 2
3: 68
4: 633
988676827_988676830 -2 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676830 5:33441192-33441214 TGCAGACGCTACGCTCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 8
988676827_988676829 -5 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676829 5:33441189-33441211 GGGTGCAGACGCTACGCTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 28
988676827_988676839 25 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676839 5:33441219-33441241 GGGGGGCAGGAAGCAGGAAGCGG 0: 1
1: 0
2: 12
3: 173
4: 1565
988676827_988676840 29 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676840 5:33441223-33441245 GGCAGGAAGCAGGAAGCGGCCGG 0: 1
1: 0
2: 7
3: 80
4: 701
988676827_988676831 -1 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676831 5:33441193-33441215 GCAGACGCTACGCTCGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 36
988676827_988676835 7 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676835 5:33441201-33441223 TACGCTCGCGGCGGGAGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 84
988676827_988676832 4 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676832 5:33441198-33441220 CGCTACGCTCGCGGCGGGAGCGG 0: 1
1: 0
2: 0
3: 3
4: 47
988676827_988676834 6 Left 988676827 5:33441171-33441193 CCAGCCTGGGACTCTAGTGGGTG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 988676834 5:33441200-33441222 CTACGCTCGCGGCGGGAGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988676827 Original CRISPR CACCCACTAGAGTCCCAGGC TGG (reversed) Intronic
900291852 1:1927068-1927090 CACCCACCATCGGCCCAGGCCGG + Intronic
900346455 1:2212744-2212766 CTCCCGCTAGACTCCCAGCCTGG - Intergenic
900806821 1:4772965-4772987 TACCCACCAGACTCCCAGACCGG + Intronic
900939243 1:5787138-5787160 CTCGCTCTACAGTCCCAGGCAGG + Intergenic
903325280 1:22565619-22565641 CACCCTCTGGAATCACAGGCTGG + Intronic
904858991 1:33520871-33520893 CCCCCACCAGAGTCTGAGGCTGG + Intronic
907044020 1:51288708-51288730 CACCCTCTAGACTGCCAGACTGG + Intronic
907274430 1:53309523-53309545 CACCCACTACAGTCACTGGCAGG + Intronic
913528426 1:119714805-119714827 CTCCCACTAGAGCACCAGGTTGG - Intronic
919972517 1:202590376-202590398 CACCCACCAGAGTGCCAATCTGG + Exonic
922717676 1:227885757-227885779 CACCCACCAGACTCGCAGGCAGG + Intergenic
1069777272 10:70934472-70934494 CACACACTGAACTCCCAGGCTGG + Intergenic
1070753533 10:78977638-78977660 CACTCACTAGAGGCCAAGGATGG + Intergenic
1075933137 10:126316406-126316428 CACCCAATAGTATCCTAGGCAGG + Intronic
1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG + Intergenic
1077405032 11:2378992-2379014 CTCCCACCAGCGTCCCAAGCAGG - Intronic
1078542554 11:12223510-12223532 CACCCACCAGGGTCCCAGGAGGG - Intronic
1079043604 11:17080517-17080539 CACCCACAAGAGTGCCTGGCGGG + Intronic
1083307814 11:61770066-61770088 CACCTACTAGAGGCCTGGGCAGG - Intronic
1083718586 11:64592832-64592854 CTCCCACCAGAATCCCAGCCAGG - Exonic
1083855465 11:65390942-65390964 CACCCACTCTGTTCCCAGGCTGG + Intronic
1084653606 11:70502749-70502771 CCCCCAGTAGGGCCCCAGGCTGG + Intronic
1087822260 11:102725765-102725787 CTCCCACTTGAGTCTCTGGCTGG + Intronic
1088224526 11:107605227-107605249 CTCCCTCCAGTGTCCCAGGCTGG + Intronic
1089202404 11:116732300-116732322 CACCCACCACAGTCCCAGCATGG + Intergenic
1089685979 11:120147132-120147154 CTCTCCCTAGAGTCTCAGGCAGG - Intronic
1089865473 11:121627712-121627734 CAGCCACTACAGCTCCAGGCTGG + Exonic
1091327114 11:134699744-134699766 CACCCAATAAATTCCCAGGTGGG - Intergenic
1094525772 12:31229688-31229710 CACACACCAGAGCCCCAGGCTGG + Intergenic
1097745852 12:63302384-63302406 AACCCTCTAGTGTCCTAGGCAGG - Intergenic
1098298394 12:69028125-69028147 CACCCAGTGCAGTGCCAGGCAGG - Intergenic
1104933574 12:132353048-132353070 CACACAGTGGCGTCCCAGGCCGG + Intergenic
1107144855 13:37049973-37049995 CACCCACCAAAGTCCCAGGAGGG + Intronic
1108586437 13:51874132-51874154 CTCACACTACTGTCCCAGGCAGG - Intergenic
1112652581 13:101415931-101415953 CACCTGCTAGATGCCCAGGCGGG + Intronic
1113035539 13:106043905-106043927 CACTCACTGGACTCCCAGGTGGG + Intergenic
1119406221 14:74401358-74401380 CTCCCACTAAAGAGCCAGGCAGG - Intergenic
1120939604 14:89934585-89934607 CACCTACCAGAGTGCCTGGCAGG + Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1122782732 14:104150430-104150452 CACTCCCCACAGTCCCAGGCAGG - Intronic
1122797414 14:104212919-104212941 CCCCCTCCAGAGGCCCAGGCAGG + Intergenic
1202837701 14_GL000009v2_random:90739-90761 TACTCACTAGGGTCCCAGTCAGG + Intergenic
1202907089 14_GL000194v1_random:80869-80891 TACTCACTAGGGTCCCAGTCAGG + Intergenic
1124559034 15:30755236-30755258 TTACCACCAGAGTCCCAGGCTGG - Intronic
1124672225 15:31650489-31650511 TTACCACCAGAGTCCCAGGCTGG + Intronic
1125513004 15:40302840-40302862 CACACACAGGACTCCCAGGCCGG - Intronic
1127090074 15:55457895-55457917 CACCCAGTTGGGCCCCAGGCTGG - Intronic
1127261741 15:57331592-57331614 CACCCAGAAGAGGCCCAGGGAGG + Intergenic
1131665596 15:94568180-94568202 CCACCTCTAGAGTCCCAGCCTGG - Intergenic
1132463767 16:68289-68311 CACCCACTTGAGGCCCAGATGGG - Intronic
1132669847 16:1098085-1098107 CACCCAGCAGCGTCCCAGGCGGG + Intergenic
1133736375 16:8619117-8619139 CCCTCCCTAGTGTCCCAGGCAGG - Intergenic
1136427282 16:30177395-30177417 CACCTACTTGTGTCCCAGGCAGG - Intergenic
1138450697 16:57092323-57092345 CAGCCACCTGAGTCCCAGCCTGG + Intergenic
1141717231 16:85733987-85734009 CACCCTTCAGATTCCCAGGCTGG - Intronic
1141952679 16:87348773-87348795 CACCCACCAGAGCAGCAGGCAGG + Intronic
1142728244 17:1831956-1831978 CCCCCACTACCGCCCCAGGCTGG + Intronic
1143112662 17:4560870-4560892 CAGTCCCTAGAGTCCCAGGTGGG - Intergenic
1143633773 17:8152877-8152899 AACCCAGGAGAGGCCCAGGCAGG - Intronic
1145781791 17:27568395-27568417 GACCCACCAGACTCCAAGGCTGG + Intronic
1150248703 17:63694294-63694316 CGTCCCCTAGAGTCCCAGGTTGG + Exonic
1152361176 17:79833841-79833863 CAACCGCGAGAGACCCAGGCTGG - Exonic
1154142248 18:11834522-11834544 TAGACACTAGAGACCCAGGCTGG - Intronic
1159021613 18:63147585-63147607 CAGACATTAGAATCCCAGGCAGG + Intronic
1159858081 18:73613368-73613390 CTCTCACTAGAGTCACTGGCAGG - Intergenic
1160174408 18:76580689-76580711 CACCCCCCAGAGGCCCAGGTGGG - Intergenic
1160733047 19:649813-649835 CACTCACCAGGGGCCCAGGCTGG + Intronic
1160733085 19:649905-649927 CACTCACCAGGGGCCCAGGCTGG + Intronic
1160733122 19:649997-650019 CACTCACCAGGGGCCCAGGCTGG + Intronic
1160733142 19:650043-650065 CACTCACCAGGGGCCCAGGCTGG + Intronic
1160733198 19:650181-650203 CACTCACCAGGGACCCAGGCTGG + Intronic
1160733218 19:650227-650249 CACTCACCAGGGGCCCAGGCTGG + Exonic
1165859196 19:38898398-38898420 CACCCTCTGGAGACCCAGGCAGG - Exonic
1165906125 19:39196086-39196108 CCCCCACCCCAGTCCCAGGCAGG + Intergenic
1168486944 19:56771375-56771397 CTCCCTCTCGAGTCCCTGGCAGG - Intergenic
1202634944 1_KI270706v1_random:36613-36635 TACTCACTAGGGTCCCAGTCAGG - Intergenic
1202650274 1_KI270706v1_random:173492-173514 TACTCACTAGGGTCCCAGTCAGG + Intergenic
1202650593 1_KI270707v1_random:437-459 TACTCACTAGGGTCCCAGTCAGG + Intergenic
925920078 2:8632364-8632386 CACCCACCACAGTCCAAGGAAGG + Intergenic
925921299 2:8639607-8639629 CACCTAATAGAGTTTCAGGCAGG + Intergenic
927171647 2:20375332-20375354 CCTCCACCAGATTCCCAGGCAGG - Intergenic
927177292 2:20419668-20419690 CCTCCACCAGATTCCCAGGCAGG - Intergenic
927621732 2:24667986-24668008 CCCCCACTAGAGTTCCACGAGGG + Intronic
930721002 2:54637917-54637939 CACCCATTTGACTCGCAGGCAGG + Intronic
931631751 2:64308253-64308275 CAGGCACCAGACTCCCAGGCAGG - Intergenic
931974822 2:67631717-67631739 CAGCCTCTAGAGTCCCAGAATGG + Intergenic
932779823 2:74553278-74553300 AACCCAGCAGATTCCCAGGCAGG + Intronic
936556754 2:113503359-113503381 GACCCGCGAGAGGCCCAGGCGGG - Intergenic
938279368 2:130053359-130053381 TACTCACTAGGGTCCCAGTCAGG - Intergenic
938330318 2:130444073-130444095 TACTCACTAGGGTCCCAGTCAGG - Intergenic
938359628 2:130677430-130677452 TACTCACTAGGGTCCCAGTCAGG + Intergenic
938436024 2:131284076-131284098 TACTCACTAGGGTCCCAGTCAGG + Intronic
941802983 2:169681692-169681714 AACTCACTATAGTCCCAGGGTGG + Intronic
947756404 2:232568935-232568957 CTTCCACTAGAATGCCAGGCAGG + Exonic
948588785 2:239036706-239036728 CACCCATCAGTCTCCCAGGCTGG + Intergenic
1171881104 20:30617798-30617820 TACTCACTAGGGTCCCAGTCAGG - Intergenic
1172231813 20:33341797-33341819 CACCCACCACAGTACCTGGCAGG + Intergenic
1172315983 20:33954792-33954814 CACCCTCTAGACTCCCAGGTCGG - Intergenic
1172882194 20:38209243-38209265 CACCCACTTTAGACCCAGACAGG - Intergenic
1175368630 20:58471861-58471883 GACCCACTCCAGCCCCAGGCTGG - Intronic
1175892800 20:62322887-62322909 TACCCACTCGTGTCCCAGCCTGG + Intronic
1176018199 20:62948910-62948932 CACCTGCCAGAGCCCCAGGCAGG + Intergenic
1176070593 20:63224318-63224340 CACCTCCTGGATTCCCAGGCTGG + Intergenic
1176102430 20:63370549-63370571 CACCCACCAAGGACCCAGGCCGG - Intronic
1176601538 21:8799059-8799081 TACTCACTAGGGTCCCAGTCAGG - Intergenic
1176626431 21:9095670-9095692 TACTCACTAGGGTCCCAGTCAGG + Intergenic
1176647157 21:9362381-9362403 TACTCACTAGGGTCCCAGTCAGG - Intergenic
1176842351 21:13851042-13851064 TACTCATTAGAGTCCCAGTCAGG - Intergenic
1180078939 21:45477657-45477679 CGCCCTCCAGAGTCCCAGGCTGG - Intronic
1180343825 22:11690610-11690632 TACTCACTAGGGTCCCAGTCAGG - Intergenic
1180365763 22:11936615-11936637 TACTCACTAGGGTCCCAGTCAGG + Intergenic
1180416946 22:12776521-12776543 TACTCACTAGGGTCCCAGTCAGG + Intergenic
1181591728 22:23889538-23889560 CACCCCCTAGAAACCCAGTCTGG - Intronic
1183247983 22:36708707-36708729 CACCCACTCCTCTCCCAGGCTGG - Intergenic
1183338650 22:37265889-37265911 CACCCGCCAGTCTCCCAGGCTGG + Intergenic
1184960337 22:47923888-47923910 CAGCACCTAGATTCCCAGGCTGG + Intergenic
950851421 3:16065431-16065453 CACCAACCAAAGTCACAGGCAGG - Intergenic
951603352 3:24401675-24401697 AACCCCCTTGTGTCCCAGGCTGG + Intronic
955679535 3:61486165-61486187 TAGCTACTAGAGTCCAAGGCAGG - Intergenic
958577518 3:95971853-95971875 CACCAACTTGAGGCCAAGGCTGG + Intergenic
961008627 3:123421716-123421738 CCCCCACTGGCCTCCCAGGCAGG + Intronic
961105223 3:124235021-124235043 AAACCACTAGGGTCCCTGGCAGG - Intronic
962709496 3:138073421-138073443 CACCCAGTAGAGTTACAGGCTGG - Intronic
1202739723 3_GL000221v1_random:42611-42633 TACTCACTAGGGTCCCAGTCAGG + Intergenic
968620204 4:1600491-1600513 CACCCACCCGAGGCCCTGGCAGG + Intergenic
973364864 4:49200865-49200887 TACTCACTAGGGTCCCAGTCAGG - Intergenic
973395728 4:49591585-49591607 TACTCACTAGGGTCCCAGTCAGG + Intergenic
973576673 4:52296716-52296738 CATGCACTAGAGTCCCTGGAAGG + Intergenic
973598711 4:52519656-52519678 CTCCCACTTCAGTCCCATGCTGG - Intergenic
975415192 4:74097882-74097904 TACCCACTTGGGTGCCAGGCTGG - Intronic
975840628 4:78470051-78470073 CAGCCACTGGAGTCCCAGGTTGG - Intronic
977193857 4:94033767-94033789 CAGTCATTAGAGTCCAAGGCAGG - Intergenic
979638938 4:122989569-122989591 CAGCCACTGTAGACCCAGGCTGG - Intronic
981041354 4:140225294-140225316 CACCCACTAGAGGCCTGAGCCGG - Intergenic
981796469 4:148600795-148600817 CACCCACTGGAGCTCCAGGCTGG + Intergenic
984529612 4:180901051-180901073 GACCCACCACAGTCCCAGGGTGG - Intergenic
1202762255 4_GL000008v2_random:122521-122543 TACTCACTAGGGTCCCAGTCAGG - Intergenic
985884805 5:2669727-2669749 CACACACTTGAGTGCCAGCCTGG + Intergenic
985893310 5:2733261-2733283 CACCCACTGGAATCCCAGCAGGG + Intergenic
986410585 5:7475066-7475088 TTCCCACCAGAGGCCCAGGCAGG - Intronic
988676827 5:33441171-33441193 CACCCACTAGAGTCCCAGGCTGG - Intronic
992034078 5:72753870-72753892 CACCCACTATAGTACCATACAGG + Intergenic
1000070000 5:157731577-157731599 CACCCAGCAGTGTGCCAGGCAGG - Exonic
1000116671 5:158160289-158160311 CACCCTCTTGAGTCCCAACCTGG - Intergenic
1000446098 5:161323133-161323155 CAGCTACTAGAGTCTGAGGCAGG - Intronic
1001307401 5:170585519-170585541 CACCCACTAGTCTCCCAGCATGG + Intronic
1001494053 5:172175494-172175516 CACCCACCAGGGTGCCAGGAGGG + Intronic
1004452181 6:15757511-15757533 CACACACCAGAGCACCAGGCTGG + Intergenic
1005949311 6:30619659-30619681 CACCCACTACACTCCCACCCAGG + Intronic
1007125738 6:39424107-39424129 CCCCCACAACATTCCCAGGCAGG + Intronic
1019336540 7:485495-485517 GACTCACTAGAGCCCCAGCCTGG - Intergenic
1023822922 7:43990092-43990114 CACCCACGTCTGTCCCAGGCTGG + Intergenic
1028151512 7:87378771-87378793 TACCCACTAGATTCCAAGGTTGG - Intronic
1028156059 7:87430937-87430959 CAACCACTAGAGATCCTGGCTGG + Intronic
1029751186 7:102543522-102543544 CACCCACGTCTGTCCCAGGCTGG + Intronic
1029769138 7:102642627-102642649 CACCCACGTCTGTCCCAGGCTGG + Exonic
1033223863 7:139545652-139545674 CACACACTGGGCTCCCAGGCAGG - Intergenic
1033379493 7:140800359-140800381 TACCCAATAGAGTCCGAGGCGGG + Exonic
1034449672 7:151130555-151130577 CACCCACCCTAGCCCCAGGCAGG - Intronic
1036122151 8:6030253-6030275 CTCCCACTAGACACCCAGTCAGG + Intergenic
1036397821 8:8383936-8383958 CACCCATCAGCGTCCCAGGAAGG - Intronic
1037768736 8:21787065-21787087 CACCACCGGGAGTCCCAGGCAGG - Intronic
1038513667 8:28164509-28164531 AACTCACTAGAGTCCCAAGAAGG - Intronic
1040291681 8:46128738-46128760 CACCCAGGATTGTCCCAGGCGGG - Intergenic
1040304749 8:46206237-46206259 CCCCCAGGACAGTCCCAGGCGGG + Intergenic
1042696032 8:71556405-71556427 CAGCCACGAGCGTCCCGGGCGGG + Intronic
1049896263 9:113979-114001 GACCCGCGAGAGGCCCAGGCGGG + Intergenic
1051796774 9:20880455-20880477 CAACCACTGGAGTCACTGGCAGG - Intronic
1053739388 9:41124176-41124198 GACCCGCAAGAGGCCCAGGCAGG + Intergenic
1054688963 9:68307146-68307168 GACCCGCAAGAGGCCCAGGCAGG - Intergenic
1057917127 9:99065495-99065517 CACCCACCACAATCACAGGCAGG - Intronic
1059673848 9:116517363-116517385 CACCCAGCAGAGCTCCAGGCTGG - Intronic
1060985073 9:127815163-127815185 CACCCTCTGGGCTCCCAGGCTGG + Exonic
1203749606 Un_GL000218v1:66084-66106 TACTCACTAGGGTCCCAGTCAGG + Intergenic
1203708368 Un_KI270742v1:72568-72590 TACTCACTAGGGTCCCAGTCAGG + Intergenic
1203543019 Un_KI270743v1:107402-107424 TACTCACTAGGGTCCCAGTCAGG - Intergenic
1190049702 X:47140582-47140604 CACCCTCCAAAGCCCCAGGCAGG + Intergenic
1190062933 X:47222597-47222619 CACCCAGTAGAGTCCCACCTCGG - Intronic
1190332787 X:49246490-49246512 CACCCACTAGATCCCCATGCTGG - Intronic
1201162972 Y:11181099-11181121 TACTCACTAGGGTCCCAGTCAGG + Intergenic