ID: 988680084

View in Genome Browser
Species Human (GRCh38)
Location 5:33476436-33476458
Sequence AGCCGCATCTCTCTGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988680079_988680084 17 Left 988680079 5:33476396-33476418 CCAATGCTGCCTATGAAAGCTGG No data
Right 988680084 5:33476436-33476458 AGCCGCATCTCTCTGCTGACTGG No data
988680081_988680084 8 Left 988680081 5:33476405-33476427 CCTATGAAAGCTGGCATCTCCAT No data
Right 988680084 5:33476436-33476458 AGCCGCATCTCTCTGCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988680084 Original CRISPR AGCCGCATCTCTCTGCTGAC TGG Intergenic
No off target data available for this crispr