ID: 988680867

View in Genome Browser
Species Human (GRCh38)
Location 5:33482487-33482509
Sequence CATTGCAAGCACAGTCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988680860_988680867 3 Left 988680860 5:33482461-33482483 CCCGCCTGTCTCATTGTCTCCCC No data
Right 988680867 5:33482487-33482509 CATTGCAAGCACAGTCCTTAAGG No data
988680861_988680867 2 Left 988680861 5:33482462-33482484 CCGCCTGTCTCATTGTCTCCCCA No data
Right 988680867 5:33482487-33482509 CATTGCAAGCACAGTCCTTAAGG No data
988680859_988680867 30 Left 988680859 5:33482434-33482456 CCTCATTAGTCTCTGGAAGAATC No data
Right 988680867 5:33482487-33482509 CATTGCAAGCACAGTCCTTAAGG No data
988680862_988680867 -1 Left 988680862 5:33482465-33482487 CCTGTCTCATTGTCTCCCCAGCC No data
Right 988680867 5:33482487-33482509 CATTGCAAGCACAGTCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988680867 Original CRISPR CATTGCAAGCACAGTCCTTA AGG Intergenic
No off target data available for this crispr