ID: 988681733

View in Genome Browser
Species Human (GRCh38)
Location 5:33490165-33490187
Sequence TGCACCCCACTGGGGAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988681733_988681739 4 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681739 5:33490192-33490214 CTTACATACCCTTATTTCAGAGG No data
988681733_988681743 10 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681743 5:33490198-33490220 TACCCTTATTTCAGAGGGGAGGG No data
988681733_988681740 5 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681740 5:33490193-33490215 TTACATACCCTTATTTCAGAGGG No data
988681733_988681750 28 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681733_988681749 27 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681749 5:33490215-33490237 GGAGGGGGAACTGAGGATTATGG No data
988681733_988681741 6 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681741 5:33490194-33490216 TACATACCCTTATTTCAGAGGGG No data
988681733_988681748 20 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681748 5:33490208-33490230 TCAGAGGGGAGGGGGAACTGAGG No data
988681733_988681744 11 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681744 5:33490199-33490221 ACCCTTATTTCAGAGGGGAGGGG No data
988681733_988681746 12 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681746 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
988681733_988681742 9 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681742 5:33490197-33490219 ATACCCTTATTTCAGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988681733 Original CRISPR TGCACCCCACTGGGGAGTTG GGG (reversed) Intergenic
No off target data available for this crispr