ID: 988681743

View in Genome Browser
Species Human (GRCh38)
Location 5:33490198-33490220
Sequence TACCCTTATTTCAGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988681736_988681743 2 Left 988681736 5:33490173-33490195 CCCCAGTGGGGTGCAGAAGCTTA No data
Right 988681743 5:33490198-33490220 TACCCTTATTTCAGAGGGGAGGG No data
988681738_988681743 0 Left 988681738 5:33490175-33490197 CCAGTGGGGTGCAGAAGCTTACA No data
Right 988681743 5:33490198-33490220 TACCCTTATTTCAGAGGGGAGGG No data
988681734_988681743 9 Left 988681734 5:33490166-33490188 CCCAACTCCCCAGTGGGGTGCAG No data
Right 988681743 5:33490198-33490220 TACCCTTATTTCAGAGGGGAGGG No data
988681735_988681743 8 Left 988681735 5:33490167-33490189 CCAACTCCCCAGTGGGGTGCAGA No data
Right 988681743 5:33490198-33490220 TACCCTTATTTCAGAGGGGAGGG No data
988681733_988681743 10 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681743 5:33490198-33490220 TACCCTTATTTCAGAGGGGAGGG No data
988681737_988681743 1 Left 988681737 5:33490174-33490196 CCCAGTGGGGTGCAGAAGCTTAC No data
Right 988681743 5:33490198-33490220 TACCCTTATTTCAGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988681743 Original CRISPR TACCCTTATTTCAGAGGGGA GGG Intergenic
No off target data available for this crispr