ID: 988681745

View in Genome Browser
Species Human (GRCh38)
Location 5:33490200-33490222
Sequence CCCCCTCCCCTCTGAAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988681745_988681752 3 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681752 5:33490226-33490248 TGAGGATTATGGGTAATTCTGGG No data
988681745_988681753 9 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681753 5:33490232-33490254 TTATGGGTAATTCTGGGAGAAGG No data
988681745_988681751 2 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681751 5:33490225-33490247 CTGAGGATTATGGGTAATTCTGG No data
988681745_988681750 -7 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681745_988681755 26 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681755 5:33490249-33490271 AGAAGGAATAAAGGATTACCAGG No data
988681745_988681754 17 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681754 5:33490240-33490262 AATTCTGGGAGAAGGAATAAAGG No data
988681745_988681749 -8 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681749 5:33490215-33490237 GGAGGGGGAACTGAGGATTATGG No data
988681745_988681756 27 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681756 5:33490250-33490272 GAAGGAATAAAGGATTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988681745 Original CRISPR CCCCCTCCCCTCTGAAATAA GGG (reversed) Intergenic
No off target data available for this crispr