ID: 988681747

View in Genome Browser
Species Human (GRCh38)
Location 5:33490201-33490223
Sequence TCCCCCTCCCCTCTGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988681747_988681756 26 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681756 5:33490250-33490272 GAAGGAATAAAGGATTACCAGGG No data
988681747_988681752 2 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681752 5:33490226-33490248 TGAGGATTATGGGTAATTCTGGG No data
988681747_988681753 8 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681753 5:33490232-33490254 TTATGGGTAATTCTGGGAGAAGG No data
988681747_988681754 16 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681754 5:33490240-33490262 AATTCTGGGAGAAGGAATAAAGG No data
988681747_988681751 1 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681751 5:33490225-33490247 CTGAGGATTATGGGTAATTCTGG No data
988681747_988681749 -9 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681749 5:33490215-33490237 GGAGGGGGAACTGAGGATTATGG No data
988681747_988681750 -8 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681747_988681755 25 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681755 5:33490249-33490271 AGAAGGAATAAAGGATTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988681747 Original CRISPR TCCCCCTCCCCTCTGAAATA AGG (reversed) Intergenic
No off target data available for this crispr