ID: 988681750

View in Genome Browser
Species Human (GRCh38)
Location 5:33490216-33490238
Sequence GAGGGGGAACTGAGGATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988681734_988681750 27 Left 988681734 5:33490166-33490188 CCCAACTCCCCAGTGGGGTGCAG No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681736_988681750 20 Left 988681736 5:33490173-33490195 CCCCAGTGGGGTGCAGAAGCTTA No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681738_988681750 18 Left 988681738 5:33490175-33490197 CCAGTGGGGTGCAGAAGCTTACA No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681737_988681750 19 Left 988681737 5:33490174-33490196 CCCAGTGGGGTGCAGAAGCTTAC No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681735_988681750 26 Left 988681735 5:33490167-33490189 CCAACTCCCCAGTGGGGTGCAGA No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681733_988681750 28 Left 988681733 5:33490165-33490187 CCCCAACTCCCCAGTGGGGTGCA No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681745_988681750 -7 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data
988681747_988681750 -8 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988681750 Original CRISPR GAGGGGGAACTGAGGATTAT GGG Intergenic
No off target data available for this crispr