ID: 988681752

View in Genome Browser
Species Human (GRCh38)
Location 5:33490226-33490248
Sequence TGAGGATTATGGGTAATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988681737_988681752 29 Left 988681737 5:33490174-33490196 CCCAGTGGGGTGCAGAAGCTTAC No data
Right 988681752 5:33490226-33490248 TGAGGATTATGGGTAATTCTGGG No data
988681738_988681752 28 Left 988681738 5:33490175-33490197 CCAGTGGGGTGCAGAAGCTTACA No data
Right 988681752 5:33490226-33490248 TGAGGATTATGGGTAATTCTGGG No data
988681747_988681752 2 Left 988681747 5:33490201-33490223 CCTTATTTCAGAGGGGAGGGGGA No data
Right 988681752 5:33490226-33490248 TGAGGATTATGGGTAATTCTGGG No data
988681736_988681752 30 Left 988681736 5:33490173-33490195 CCCCAGTGGGGTGCAGAAGCTTA No data
Right 988681752 5:33490226-33490248 TGAGGATTATGGGTAATTCTGGG No data
988681745_988681752 3 Left 988681745 5:33490200-33490222 CCCTTATTTCAGAGGGGAGGGGG No data
Right 988681752 5:33490226-33490248 TGAGGATTATGGGTAATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988681752 Original CRISPR TGAGGATTATGGGTAATTCT GGG Intergenic
No off target data available for this crispr