ID: 988682954

View in Genome Browser
Species Human (GRCh38)
Location 5:33501967-33501989
Sequence CTCAGGGCCCGGGTTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988682954_988682969 18 Left 988682954 5:33501967-33501989 CCAGTGAGAACCCGGGCCCTGAG No data
Right 988682969 5:33502008-33502030 GGGCTGAGTCTGGGGCGCGCAGG No data
988682954_988682967 9 Left 988682954 5:33501967-33501989 CCAGTGAGAACCCGGGCCCTGAG No data
Right 988682967 5:33501999-33502021 AGTTTGCTGGGGCTGAGTCTGGG No data
988682954_988682962 -4 Left 988682954 5:33501967-33501989 CCAGTGAGAACCCGGGCCCTGAG No data
Right 988682962 5:33501986-33502008 TGAGCCGGGCGGTAGTTTGCTGG No data
988682954_988682964 -2 Left 988682954 5:33501967-33501989 CCAGTGAGAACCCGGGCCCTGAG No data
Right 988682964 5:33501988-33502010 AGCCGGGCGGTAGTTTGCTGGGG No data
988682954_988682968 10 Left 988682954 5:33501967-33501989 CCAGTGAGAACCCGGGCCCTGAG No data
Right 988682968 5:33502000-33502022 GTTTGCTGGGGCTGAGTCTGGGG No data
988682954_988682966 8 Left 988682954 5:33501967-33501989 CCAGTGAGAACCCGGGCCCTGAG No data
Right 988682966 5:33501998-33502020 TAGTTTGCTGGGGCTGAGTCTGG No data
988682954_988682963 -3 Left 988682954 5:33501967-33501989 CCAGTGAGAACCCGGGCCCTGAG No data
Right 988682963 5:33501987-33502009 GAGCCGGGCGGTAGTTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988682954 Original CRISPR CTCAGGGCCCGGGTTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr