ID: 988683004

View in Genome Browser
Species Human (GRCh38)
Location 5:33502156-33502178
Sequence CTGAAGCCTGGATGCTAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 179}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988683004_988683015 4 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683015 5:33502183-33502205 CCGCCGCTGGGAGGCGGCCTGGG No data
988683004_988683013 3 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683013 5:33502182-33502204 GCCGCCGCTGGGAGGCGGCCTGG No data
988683004_988683012 -2 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683012 5:33502177-33502199 AGGCTGCCGCCGCTGGGAGGCGG 0: 1
1: 1
2: 5
3: 35
4: 305
988683004_988683019 21 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683019 5:33502200-33502222 CCTGGGCGCCAGGACCAGTGTGG 0: 1
1: 0
2: 3
3: 33
4: 246
988683004_988683011 -5 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683011 5:33502174-33502196 TTCAGGCTGCCGCCGCTGGGAGG 0: 1
1: 2
2: 5
3: 19
4: 427
988683004_988683021 28 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG 0: 1
1: 0
2: 3
3: 19
4: 178
988683004_988683020 22 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683020 5:33502201-33502223 CTGGGCGCCAGGACCAGTGTGGG 0: 1
1: 0
2: 2
3: 18
4: 206
988683004_988683009 -9 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683009 5:33502170-33502192 AGGCTTCAGGCTGCCGCCGCTGG 0: 1
1: 0
2: 3
3: 14
4: 161
988683004_988683017 11 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683017 5:33502190-33502212 TGGGAGGCGGCCTGGGCGCCAGG 0: 1
1: 0
2: 4
3: 33
4: 470
988683004_988683010 -8 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683010 5:33502171-33502193 GGCTTCAGGCTGCCGCCGCTGGG 0: 1
1: 2
2: 1
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988683004 Original CRISPR CTGAAGCCTGGATGCTAGGG CGG (reversed) Intergenic
900567541 1:3340998-3341020 CTGAAGGCTCCAGGCTAGGGAGG + Intronic
902808885 1:18877249-18877271 CTGCAGGCTGGAGGCAAGGGAGG + Exonic
904410233 1:30320616-30320638 CTGGAGCCTGGAGGCCAGGGAGG - Intergenic
904942608 1:34176026-34176048 CTGGAGCCTGTATACTAGCGAGG - Intronic
906612009 1:47209991-47210013 CTCTACCCTGGATTCTAGGGAGG + Intergenic
907308293 1:53525622-53525644 CTGAGGCCTGGAGGGCAGGGTGG - Intronic
908530339 1:65027843-65027865 CTGCACCCTGGATGCTGGGGTGG + Intergenic
909979496 1:82081839-82081861 CTGGAGACTGGAAGTTAGGGAGG - Intergenic
912403985 1:109421063-109421085 CTGTACCCTAGCTGCTAGGGAGG + Intronic
912598004 1:110898849-110898871 CAGAAGCCTTGCTGCTAGGATGG - Intronic
913410105 1:118542099-118542121 CTGAAGCCTGGAGGCTGGAAAGG - Intergenic
916167329 1:161975791-161975813 CTGAGGCCTTGATCCTGGGGGGG - Intergenic
916691910 1:167198126-167198148 CTGCGGCCTGGATGCCAGAGTGG - Intergenic
918356371 1:183709275-183709297 CTGAGGCCTGGAAGCTGGGCGGG - Intronic
919585791 1:199437934-199437956 CTGATGTCTGGATCCTAAGGTGG - Intergenic
920166231 1:204038043-204038065 GTGCAGCCTCAATGCTAGGGTGG + Intergenic
922749282 1:228063143-228063165 CTGAAGTGTGGCTGCTGGGGTGG + Intergenic
924213384 1:241793635-241793657 CTGAAGACAGGGTGCTAAGGAGG + Intronic
924336217 1:242989120-242989142 CTTAAGCCCTGATACTAGGGGGG + Intergenic
1062816051 10:500831-500853 CTGAAGCCTGAAACCTATGGGGG - Intronic
1069000364 10:63256540-63256562 CTGAAGCCTCGATAGTAGGATGG - Intronic
1069593658 10:69656805-69656827 CTGAAGCCAGCATGCTTGTGAGG - Intergenic
1070474416 10:76817789-76817811 AAGATGCCTGGCTGCTAGGGTGG + Intergenic
1071687879 10:87780807-87780829 CTGAAGCCAAGATGCTTGGAAGG + Intronic
1072188409 10:93062522-93062544 CTGGAGCCTGGATGGTTGGGAGG + Intronic
1073662889 10:105496908-105496930 CTGGAGCCTGGATTCTATGGAGG - Intergenic
1077356283 11:2120401-2120423 CTGAGGGCTGGGTGCTGGGGAGG + Intergenic
1077437330 11:2549255-2549277 CTGGTGCCAGGATGCTGGGGTGG + Intronic
1078335054 11:10456664-10456686 CTGAAGCCAGCAGGCTTGGGAGG - Intronic
1079127567 11:17729960-17729982 CTGAAGCCTGGAAGTTTTGGGGG - Intergenic
1080811895 11:35712759-35712781 CTGAAGCGTGGCTGCTATGGGGG - Intronic
1083921698 11:65784512-65784534 CTGAGGCCTGAATGAGAGGGTGG - Intergenic
1084575714 11:69986681-69986703 ATGAGGCCTGGACGCTAGGCCGG + Intergenic
1084579946 11:70017003-70017025 CGGCAGCCTGGATTCTAGAGGGG - Intergenic
1084921512 11:72474525-72474547 CTGAAGCCTGGATTCAGTGGTGG + Intergenic
1085198433 11:74686319-74686341 CTGATGCCTGGATTGTAGGCTGG + Intergenic
1086333300 11:85775512-85775534 CTCTAGCCTGGATGATAGAGTGG - Intronic
1088829272 11:113521553-113521575 CTGAATCTTGGATTCTAGTGAGG + Intergenic
1088848041 11:113683915-113683937 CTGCAGCATGTCTGCTAGGGAGG + Intergenic
1089308432 11:117541827-117541849 CAGAAGCCGGGATGCTACTGAGG - Intronic
1089337735 11:117736551-117736573 CTGAAGGCTGGCTGCCATGGGGG + Intronic
1089627849 11:119762775-119762797 CAGAAGCCCAGATGCAAGGGTGG + Intergenic
1091284332 11:134399643-134399665 CTGGACCCTGGAAGCTAGGAGGG + Intronic
1096477222 12:51915684-51915706 CTGGAGCCAGGATGGTATGGTGG - Intronic
1098762639 12:74444478-74444500 CTGAAACCTGAATGATAGGAAGG - Intergenic
1099870528 12:88343596-88343618 CTGAAGCCTGGCTACGTGGGAGG - Intergenic
1101430029 12:104619126-104619148 CTGAATCCTGCCTGCTAGGATGG - Intronic
1103562343 12:121799408-121799430 CTGATGTCTGGCTGCTAGAGAGG - Intronic
1104646421 12:130500986-130501008 GTGACCCCTGGATGCTCGGGTGG - Intronic
1104946273 12:132416253-132416275 CTGGGGCCAGGCTGCTAGGGCGG - Intergenic
1107087995 13:36446709-36446731 CTGGAGCCAGGATGCCAGTGGGG - Intergenic
1107188074 13:37547274-37547296 CTCAAGCCTGAAGGCTATGGAGG + Intergenic
1112059800 13:95727029-95727051 CTGAAGACTGGGTGGTGGGGAGG + Intronic
1113449485 13:110396988-110397010 GTGAAGCCTGGGTGCTCAGGAGG - Intronic
1114073422 14:19132820-19132842 GTGAAGCCTGGCGGCGAGGGCGG + Intergenic
1114388746 14:22283123-22283145 CAGAAGCCTGGGTGCTAAGCTGG - Intergenic
1117921344 14:60728089-60728111 CTGCTGCCTGGATGATAGGGGGG + Intergenic
1118192699 14:63594715-63594737 CTGAAGCTTGGTTTCTAGGTAGG + Intergenic
1119994665 14:79240311-79240333 CTGAAGCATGGTTGCTGGGGTGG - Intronic
1122716627 14:103700204-103700226 CTAAGGCCTGGATGCACGGGAGG - Intronic
1122760364 14:104020436-104020458 TTCCAGCCTGGATGCTGGGGAGG + Intronic
1122974567 14:105165798-105165820 TTTCAGCCTGGAGGCTAGGGTGG - Intronic
1124460769 15:29889623-29889645 CTGCAGCCTGGCTGCTGGAGAGG - Intronic
1124822288 15:33058131-33058153 CTGAAGCCAGGATGGTGGAGAGG + Intronic
1129348492 15:74939567-74939589 CTGAAGCCACACTGCTAGGGAGG - Intergenic
1130955448 15:88624083-88624105 CTGAAGCAGAGGTGCTAGGGAGG - Intronic
1131540795 15:93273451-93273473 CTGCTCCCTGGATGCAAGGGAGG - Intergenic
1131927428 15:97401148-97401170 CTGAGGCCTGGAGGGTGGGGCGG - Intergenic
1134138963 16:11700281-11700303 CTGGAGCCTGGGCTCTAGGGTGG + Intronic
1135906003 16:26512275-26512297 CTGAAGCCAGGCTTCTAGGATGG + Intergenic
1136454294 16:30371584-30371606 CTGGAGCCTGGGTTCTGGGGAGG - Intronic
1137015332 16:35368578-35368600 CTGAAACCTGCATGCTTGGGTGG + Intergenic
1138401178 16:56745487-56745509 CTGAAGCTGGGAGGTTAGGGAGG + Intronic
1143252625 17:5534461-5534483 CTCTAGCCTGGATGCATGGGTGG - Intronic
1144049622 17:11487328-11487350 CTAAAGCCTGAAAGTTAGGGTGG + Intronic
1149529876 17:57386643-57386665 CTGAAGCCTCCATGCTGGAGGGG + Intronic
1151885921 17:76923394-76923416 CTGAACCCTGAATCCTGGGGAGG + Intronic
1152386507 17:79977953-79977975 CAGAGGCCTGGATGCTGAGGGGG + Intronic
1155320747 18:24616395-24616417 CTAAAGGCTGGCTTCTAGGGTGG + Intergenic
1157674706 18:49560764-49560786 CTGGATCCTCGACGCTAGGGAGG + Intronic
1159429429 18:68332302-68332324 CTGAAGAATCGCTGCTAGGGTGG + Intergenic
1160460884 18:79037295-79037317 CTGGAGCCAGGATGCCTGGGTGG - Intergenic
1160460902 18:79037371-79037393 CTGGAGCCAGGATGCCTGGGTGG - Intergenic
1160460937 18:79037523-79037545 CTGGAGCCAGGATGCCTGGGTGG - Intergenic
1160460973 18:79037673-79037695 CTGGAGCCAGGATGCCTGGGTGG - Intergenic
1160817645 19:1043478-1043500 GGGCAGCCTGGATGCTGGGGTGG + Intronic
1161714677 19:5868468-5868490 GTGAGGCTTGGATGCCAGGGTGG + Intronic
1162480614 19:10924871-10924893 CGGAAGCCAGGAGGCTGGGGTGG - Intronic
1163456154 19:17406776-17406798 CTCAAGCCTGGGTGATAGAGTGG + Intronic
1164696022 19:30245047-30245069 CTGAAGCCTGGTGGATGGGGTGG - Intronic
1165141525 19:33702928-33702950 CTGAAGGCTGGGGGCTGGGGAGG + Intronic
1165241989 19:34476343-34476365 CTCCAGCCTGGATGACAGGGTGG + Intergenic
1165668527 19:37655233-37655255 CTGAGGCCTGGAGGCCCGGGCGG - Exonic
1166902869 19:46079563-46079585 CTGAGGCCTGGAAACTCGGGTGG - Intergenic
1167344337 19:48935933-48935955 CTGGTCCCTGGGTGCTAGGGCGG + Intronic
1167438050 19:49491248-49491270 CTGATGCCAGGAGGCTTGGGTGG + Intronic
1168096441 19:54118144-54118166 GTGGAGCCTGCATGCTAGTGGGG + Intronic
932522443 2:72427771-72427793 CTGAAGGCTGGGGGCTAGGCTGG + Intronic
934556494 2:95289522-95289544 CTGGAGCCTGGACCCTGGGGTGG + Exonic
940396624 2:153197847-153197869 CGGCAGCCTTGCTGCTAGGGTGG + Intergenic
944862010 2:203824116-203824138 CTGAGGTCTGGATGAGAGGGTGG + Intergenic
946075055 2:217066945-217066967 CTGTGACCTGGATGCTAAGGTGG + Intergenic
947840941 2:233207633-233207655 CTCCAGCCTGGCTGCCAGGGAGG + Exonic
948214984 2:236221939-236221961 CTGAAGGCTGGGTCCCAGGGTGG + Intronic
948322675 2:237083123-237083145 TTGGAGCCTGGATGCCAGAGAGG - Intergenic
948461989 2:238134264-238134286 CTGAGGCCTGGAGGCTATGGAGG - Intergenic
948798864 2:240421075-240421097 ATGAGGCCTGGATGCTAGTTTGG - Intergenic
1168994248 20:2120887-2120909 CTGAAGCTTGGGTGGTGGGGAGG + Intronic
1168995313 20:2128722-2128744 GTGAAGTCTGAATGGTAGGGAGG + Intronic
1173004436 20:39128877-39128899 CTGAAGCCCTGATGGTAGAGTGG - Intergenic
1173497489 20:43530064-43530086 CTGAGTTCTGGATGCAAGGGAGG - Intronic
1173574272 20:44100583-44100605 CTGCAGCCTGGATTCTCGTGGGG - Intergenic
1173994136 20:47324816-47324838 CTGGAGGCTGGAGGCTGGGGTGG - Intronic
1176428471 21:6562619-6562641 CTGTCACCTGGATGCCAGGGTGG + Intergenic
1177293783 21:19149138-19149160 CTGAAATCTGGATGCTATGTTGG - Intergenic
1178169157 21:30019405-30019427 CTGGAGGCAGGATGGTAGGGAGG + Intergenic
1179041612 21:37807916-37807938 CTGAACCCTGGATGCCTGGTTGG - Intronic
1179560145 21:42210686-42210708 CAGATGCCTGGAAGCTATGGTGG - Intronic
1179703961 21:43170935-43170957 CTGTCACCTGGATGCCAGGGTGG + Intronic
1179999103 21:44987105-44987127 CTGACCACTGGCTGCTAGGGTGG + Intergenic
1181669670 22:24420292-24420314 CTGGAGCCTGGATGGAAGGAAGG + Intronic
1181984686 22:26791760-26791782 CTGAAGCCAGGTAGCTGGGGTGG - Intergenic
1183030330 22:35099049-35099071 CTGAAGCTTGCATGCTATAGGGG - Intergenic
949503898 3:4708391-4708413 CTGGAGCCAGGAAGCTGGGGAGG + Intronic
950833016 3:15893831-15893853 CTGCAGCCTGAATGTTGGGGAGG - Intergenic
951081535 3:18455868-18455890 CTGCAGCCTGGGTGATAGAGTGG - Intergenic
954559641 3:51545887-51545909 CTGAAGGCTGGGTGTTAGGAAGG + Intronic
955016928 3:55079500-55079522 CTGAGGCCTGGATGACAAGGAGG - Intergenic
955134030 3:56198431-56198453 CTGAAGCAGGGAGGCCAGGGAGG + Intronic
959860529 3:111210314-111210336 CTGAAGAATGGAGGCAAGGGAGG - Intronic
961538844 3:127586925-127586947 CAGCAGCCTGGATGCTGGGCAGG - Intronic
961976936 3:131035536-131035558 CTGAGGCCTGGACCCCAGGGTGG - Intronic
963256127 3:143146586-143146608 CTGCTGCCTGGATGCAAGGCTGG + Intergenic
963440807 3:145336977-145336999 TTGTAGCCTGGATGCTTGGCTGG - Intergenic
964857393 3:161161760-161161782 ATGAAGCCAGGCGGCTAGGGCGG + Intronic
965289921 3:166865522-166865544 CTGAAGCCTGGAAGCCAGGCTGG + Intergenic
967082690 3:186064832-186064854 CTGACTCCTGGGTGTTAGGGTGG + Intronic
969047041 4:4343946-4343968 CTGCAGCCTGGATGACAGAGCGG - Intergenic
969398349 4:6937825-6937847 CTGAAGCCTGGAGGGTAGTGGGG + Intronic
977564371 4:98566678-98566700 TGGAAGCCTGGATGCTGTGGAGG + Intronic
977996937 4:103505643-103505665 CTGAAGCCTCGCTTCTTGGGGGG - Intergenic
978193546 4:105943941-105943963 CTGCAGCCTGGGTGACAGGGTGG + Intronic
978531513 4:109719489-109719511 CTGAACCCTTGATGCTACTGGGG - Intronic
979240911 4:118446191-118446213 CTCAAGCCCTGATACTAGGGGGG - Intergenic
983302582 4:165946365-165946387 CTCAAGCCTGGATGACAGTGTGG - Intronic
984708259 4:182863581-182863603 CTGCAGCCTGGAGGCTGGAGGGG - Intergenic
986317585 5:6600906-6600928 GTGGAGCCTGGAAGGTAGGGAGG - Intronic
988683004 5:33502156-33502178 CTGAAGCCTGGATGCTAGGGCGG - Intergenic
998622623 5:143811684-143811706 CTGGAGCCTGCATTCTAGTGTGG + Intergenic
999978846 5:156939539-156939561 CTGACTCATGGATGCTTGGGTGG - Intronic
1000199049 5:158989326-158989348 CTGAAAGCAGGCTGCTAGGGTGG + Intronic
1001249779 5:170138137-170138159 CTGGAGCCTGGAGCCTAGAGAGG - Intergenic
1001300563 5:170530694-170530716 CTGAGCCCTGGATGCAAGCGTGG - Intronic
1006400101 6:33812817-33812839 CTGCAGGCTGGAAGCTGGGGAGG - Intergenic
1007133292 6:39497018-39497040 CTGAAGCCTGCCTGCAAAGGCGG - Intronic
1009846903 6:69146004-69146026 CTAAAGCCTGGAGGCTGGGCTGG - Intronic
1010973899 6:82291683-82291705 CTGAAACCTTCATGCTAGAGAGG + Intergenic
1013635862 6:112028641-112028663 CTGAGGGCTGGATGGAAGGGAGG - Intergenic
1015410388 6:132887329-132887351 CTGAATCTTGGATGCATGGGTGG + Intergenic
1015684393 6:135843246-135843268 CTGAAGCCTGCAGGCTAGCGGGG + Intergenic
1017856395 6:158353139-158353161 CTGAAGCCAGGAGGCCTGGGAGG - Intronic
1017881852 6:158567553-158567575 CTGAACCCTGGATGCTGGGTGGG + Intronic
1018287276 6:162254422-162254444 CTCCAGCCTGGGTGATAGGGTGG + Intronic
1018835501 6:167480389-167480411 CTGAAGTCTGGAAACCAGGGTGG - Intergenic
1019816531 7:3205156-3205178 GTGGAGCCTGCATTCTAGGGAGG - Intergenic
1020310857 7:6867469-6867491 CTGAAGCCAGGATGCTGAGCAGG + Intergenic
1020399719 7:7761604-7761626 CTCAAGTTTGGATGGTAGGGAGG + Intronic
1020418889 7:7976888-7976910 CTCCAGCCTGGGTGCTAGAGTGG + Intronic
1022514923 7:30969431-30969453 CAGAAGCCTGGCTGCAAGGGTGG + Intronic
1023775335 7:43600294-43600316 CTGAAAACTGAATTCTAGGGAGG - Intronic
1023905239 7:44517139-44517161 CTGGAGACTGGAGGTTAGGGTGG - Intronic
1024282798 7:47733331-47733353 CTGCAGCCTGGAAGGTAGGTGGG + Intronic
1024771576 7:52730040-52730062 CTGGAGCCAGGATGCCAGGTAGG + Intergenic
1025988375 7:66475390-66475412 CTGAGCACTGGATGCTAGGTGGG - Intergenic
1026465207 7:70647750-70647772 CTGAAGCTAGCATGCCAGGGAGG + Intronic
1028373832 7:90123686-90123708 CTGAATCCTGGCTGCTAGGGAGG - Intergenic
1033274713 7:139962673-139962695 CTGAAGACTGGAAGCTGAGGAGG + Intronic
1035275211 7:157744223-157744245 CAGAAGCCGTGATGCTGGGGTGG + Intronic
1045362921 8:101449588-101449610 CTGAAGCCTCCATGCTGGAGAGG + Intergenic
1046255633 8:111693746-111693768 CTGATGCCTCCAAGCTAGGGAGG - Intergenic
1047219548 8:122908671-122908693 CTGATGCCTGGATGCTGAGTGGG - Intronic
1049761976 8:144335899-144335921 CTGGAGCCTGGACGGTAGAGGGG - Intronic
1052993101 9:34533619-34533641 CAGCAGCCTGGATGCTTGAGTGG - Intergenic
1055668166 9:78572930-78572952 CTGAAACCTGAGTGCTAAGGTGG + Intergenic
1057512680 9:95693740-95693762 CTGAAGCCACCATGCTGGGGAGG - Intergenic
1057879899 9:98785477-98785499 CTGAAGCCCAGCTGCTAGGCTGG + Intronic
1061247457 9:129408065-129408087 CTGAAGCCAGGAAGCCAGGGAGG - Intergenic
1062256712 9:135626599-135626621 CTGAAGCCAGGATGGGAGGCAGG + Intronic
1187478329 X:19631543-19631565 CTGCAGCCTGGCTGCTGTGGAGG + Intronic
1188041460 X:25374643-25374665 CAGAACCCTGGCTGCTAGGCAGG - Intergenic
1189772724 X:44442292-44442314 ATGAAGACTGGATGGTAGGCAGG + Intergenic
1189773042 X:44444973-44444995 ATGAAGACTGGATGGTAGGCAGG + Intergenic
1191720333 X:64223612-64223634 CTGAAGCCTAGAAGTTAGGTTGG + Intergenic
1191742057 X:64446805-64446827 CTGAAACCTGGATGAGAGGTGGG - Intergenic
1192659691 X:73029460-73029482 CTGCAGGCTTGCTGCTAGGGAGG - Intergenic
1200216348 X:154369712-154369734 CTCAGTCCTGGATGGTAGGGGGG - Intronic