ID: 988683021

View in Genome Browser
Species Human (GRCh38)
Location 5:33502207-33502229
Sequence GCCAGGACCAGTGTGGGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988683004_988683021 28 Left 988683004 5:33502156-33502178 CCGCCCTAGCATCCAGGCTTCAG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG 0: 1
1: 0
2: 3
3: 19
4: 178
988683006_988683021 25 Left 988683006 5:33502159-33502181 CCCTAGCATCCAGGCTTCAGGCT 0: 1
1: 0
2: 3
3: 20
4: 230
Right 988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG 0: 1
1: 0
2: 3
3: 19
4: 178
988683014_988683021 1 Left 988683014 5:33502183-33502205 CCGCCGCTGGGAGGCGGCCTGGG No data
Right 988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG 0: 1
1: 0
2: 3
3: 19
4: 178
988683007_988683021 24 Left 988683007 5:33502160-33502182 CCTAGCATCCAGGCTTCAGGCTG 0: 1
1: 1
2: 21
3: 88
4: 478
Right 988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG 0: 1
1: 0
2: 3
3: 19
4: 178
988683008_988683021 16 Left 988683008 5:33502168-33502190 CCAGGCTTCAGGCTGCCGCCGCT 0: 1
1: 5
2: 0
3: 19
4: 182
Right 988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG 0: 1
1: 0
2: 3
3: 19
4: 178
988683016_988683021 -2 Left 988683016 5:33502186-33502208 CCGCTGGGAGGCGGCCTGGGCGC No data
Right 988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG 0: 1
1: 0
2: 3
3: 19
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988683021 Original CRISPR GCCAGGACCAGTGTGGGTCG AGG Intergenic
901277524 1:8004206-8004228 GCCAGGAGCAGTGTTGGTCTCGG + Intergenic
901493577 1:9608891-9608913 TCCATTACCAGAGTGGGTCGGGG + Intronic
901650413 1:10739798-10739820 GCCAGGACCAGTGGGGGAGGTGG - Intronic
902268993 1:15289555-15289577 GGCAGGACCACGGTGGGTCTGGG - Exonic
903173356 1:21567021-21567043 CCCAGGACCAGCCTGGGTCCAGG - Intronic
903266999 1:22163577-22163599 GCCAGGAGCAGTGGGGGCAGGGG + Intergenic
905515795 1:38561032-38561054 GCCAAGACCTGTGTTGGTAGAGG - Intergenic
906102704 1:43273273-43273295 GCCATGGCCACTGTGGGTGGAGG - Exonic
906527833 1:46506767-46506789 GGCAGGGCCAGTGTGGGTTTAGG - Intergenic
907108210 1:51903239-51903261 GCCAGAACCTGTGTGGGACCCGG + Intergenic
914523040 1:148435047-148435069 GGGAGGCCTAGTGTGGGTCGCGG + Intergenic
914961582 1:152213997-152214019 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914961830 1:152215407-152215429 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914962077 1:152216817-152216839 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914962327 1:152218227-152218249 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914962451 1:152218932-152218954 GCCACGGCCAGCGTGGGTCTGGG - Exonic
914962691 1:152220333-152220355 GCCACGGCCAGCGTGGGTCTGGG - Exonic
915146109 1:153796568-153796590 GCCAGGCCCAGTGTGGGCACTGG + Intergenic
916214478 1:162383738-162383760 GCCAGGGCCAGTGTGCGCAGTGG - Intronic
922504328 1:226117910-226117932 GGCAGGACCAGAGTGGGTCTAGG + Intergenic
923130894 1:231073818-231073840 GCCAGGACCAGTGTGTGGTCAGG - Intergenic
1062910439 10:1208621-1208643 GCCAGGCCCACTGGGGGTCCAGG - Intronic
1062925791 10:1314549-1314571 GCCAGGGCAAGTGTGGGAAGAGG - Intronic
1064544425 10:16436817-16436839 CCCCGGACCAGGGTGGGGCGTGG + Intergenic
1065801772 10:29358926-29358948 ACCAGGACCAGCATGGGTGGTGG + Intergenic
1069957832 10:72062495-72062517 GCCAGGAGCAGTGTGGATCAAGG + Exonic
1071475238 10:86019833-86019855 CCCAGGGCCAGGGTGGTTCGAGG + Intronic
1071570626 10:86694811-86694833 GCCTGGACCAGGGTGGGACAAGG - Intronic
1074229559 10:111520316-111520338 GGCATCACCAGTGTGGGTGGAGG - Intergenic
1075344177 10:121670281-121670303 GCCCGGCCCAGTGTGGGTGTTGG + Intergenic
1075848058 10:125562863-125562885 GGCAGGACAAGATTGGGTCGTGG - Intergenic
1076309431 10:129493689-129493711 GCCAGGCCCAGTGTGGGATCTGG + Intronic
1076746408 10:132517029-132517051 GCCAGGGCCACAGTGGGGCGGGG + Intergenic
1077033838 11:484324-484346 TCCAGGACCAGGGTGGGGAGTGG - Intronic
1077317678 11:1926631-1926653 GAGAGGACCAGTGTGAGTGGTGG - Intronic
1082796390 11:57381068-57381090 GGCAGGACCAGTGTAGGCCCTGG - Intronic
1082892538 11:58155534-58155556 GCCAGGACCAGGGTGAGGCAAGG - Intronic
1084062825 11:66687160-66687182 GCCAGGACCTGCGAGGGACGCGG + Exonic
1084108519 11:66997372-66997394 GCCAGCTCCAGTGTGGCTCATGG + Intergenic
1084643042 11:70437259-70437281 GACAGGCCCTGTGTGGGACGGGG - Intergenic
1085205631 11:74730649-74730671 GTGAGGACCAGTATGGGCCGGGG - Intronic
1096180471 12:49547889-49547911 GCCAGGACCTCTGTGGATCTTGG + Intronic
1096649218 12:53053704-53053726 GCAAGGACCAATGTGGGCCTTGG - Intronic
1101423261 12:104566495-104566517 GCCAGGACCTGTGGGGATGGAGG - Intronic
1103033659 12:117639192-117639214 GCCAGGACTAGGGTGGGGCTGGG - Intronic
1103202614 12:119100686-119100708 GCCAGGACAAGTATGGGAAGAGG + Intronic
1104513268 12:129401059-129401081 GCCAGGCCCAGTGTGGGAAAGGG - Intronic
1104900483 12:132187383-132187405 AGCAGGACCAGTGTGGCCCGGGG + Intergenic
1106354006 13:28962295-28962317 GCCAGGAACAGTGTGGGAGAGGG - Intronic
1107015504 13:35705479-35705501 GCCAGGACCTAGGTGGGGCGGGG + Intergenic
1107868935 13:44729543-44729565 GCCAGGAGCACTGTGGGCCAAGG + Intergenic
1113383225 13:109823224-109823246 ACCAGGACCTGTGTGGGGTGGGG - Intergenic
1117989547 14:61420246-61420268 GCCAGGCCCAGAGTGGCTCTGGG - Intronic
1120592424 14:86391356-86391378 GCCAGGAGCAGTGTGGCTAGGGG - Intergenic
1122217484 14:100213944-100213966 GCGAGGACCAGGCTGGGGCGAGG + Intergenic
1123421382 15:20139832-20139854 GCCAGGGCCAGTGTAGGGTGAGG + Intergenic
1123530608 15:21146372-21146394 GCCAGGGCCAGTGTAGGGTGAGG + Intergenic
1124803062 15:32853820-32853842 GCCAGGCCCAGAGTGGGCAGGGG + Intronic
1125274811 15:37978920-37978942 AGCAGGACCAAGGTGGGTCGAGG + Intergenic
1126518161 15:49558205-49558227 GCAAGGAGCAGTGTGGGTAGGGG - Intronic
1128419718 15:67480069-67480091 GCCTGCACCAGTGTGGGGCAGGG + Intronic
1128902586 15:71438090-71438112 GCTGGGACCAGGGTGGGTAGGGG - Intronic
1129625553 15:77194621-77194643 GCTAAGACTAGTGGGGGTCGGGG - Intronic
1132120278 15:99169758-99169780 GCTAGGACCAGTGGGGGCGGGGG + Intronic
1133237164 16:4392712-4392734 GCCAGGGCCGGTGTGAGCCGAGG - Intronic
1134006578 16:10822237-10822259 GCCAAGACCAGTGTGGGTAGGGG - Intergenic
1134124152 16:11605043-11605065 GCCAGGACCACTGCTGGACGTGG + Intronic
1136412562 16:30085865-30085887 GCCTGCACCAGTGTGTGTGGGGG + Exonic
1137589653 16:49685802-49685824 TCTAGGAGCAGTGTGGGTGGTGG - Intronic
1138166027 16:54802451-54802473 GCCTGGACCAGTGAGGGGAGGGG + Intergenic
1138330612 16:56212365-56212387 TCCAGGACCATTGCGGGTGGAGG - Intronic
1138490432 16:57373119-57373141 CCCAGGACCAGTGAAGGTCAAGG + Intronic
1139437304 16:66943647-66943669 GTCAGCACCAGTGGGGGTTGGGG - Intronic
1140404547 16:74700232-74700254 CCCAGTAGCAGTGGGGGTCGTGG - Intronic
1141837951 16:86555098-86555120 GCCGGGACCGGTGAGGGTCGAGG - Intronic
1142253579 16:89003270-89003292 GCCAGGCTCAGTGGGGGTCAGGG + Intergenic
1142712810 17:1732598-1732620 GCGAGGACCAGGGTGGGCCAGGG + Intronic
1143464155 17:7124481-7124503 GCCAGGTCCAGAGTGAGCCGAGG + Intergenic
1144659773 17:17060437-17060459 GCCAGGGCCAGTGTGGAACCAGG + Intronic
1144763073 17:17718193-17718215 GCCAGAACCTGCATGGGTCGGGG + Intronic
1146054804 17:29575741-29575763 GCTAGGGGCAGTGTGGGTCCAGG - Intronic
1147567401 17:41546188-41546210 GCCTGGAGAAGTGTGGGTCGGGG + Intergenic
1148764040 17:50027263-50027285 GCCGGGACCAGAGTGGGCCATGG + Intergenic
1148974926 17:51519166-51519188 GCCAAGACCTGTGTCGGGCGCGG - Intergenic
1150735294 17:67731764-67731786 GCCAGGACCACTGTGGTGCTGGG - Intronic
1151194398 17:72421354-72421376 GCCAGCACCTGTCTGGGACGTGG - Intergenic
1152058533 17:78051123-78051145 GACAGGAACAGGGTGGATCGGGG + Exonic
1152210499 17:79000678-79000700 GCCAGGGCCAGTGTGGTCAGGGG - Intronic
1152305773 17:79519430-79519452 GCCAGGACCAGGGTGGGTACGGG + Intergenic
1152822829 17:82445853-82445875 GCCACGACCAGGGTGAGTCGTGG - Exonic
1156473108 18:37389796-37389818 GCCAGATTCAGTGTGGGTGGGGG - Intronic
1156523514 18:37742690-37742712 CCCAGGACCACTGTGGGAGGAGG + Intergenic
1160006932 18:75074887-75074909 GCCAGGAGGAGTGAGGGTGGTGG + Intergenic
1160461741 18:79043874-79043896 ACCAGGAACGGTGTGGGTCCTGG + Intergenic
1160474502 18:79170218-79170240 CCCAGGCCCAGTGTGGCTCTGGG - Intronic
1161108223 19:2455125-2455147 ACCAGGCCCAGGGTGGGTAGGGG - Intronic
1161157154 19:2738456-2738478 GAAAGGACCAGTGAGGGCCGAGG - Intronic
1162460454 19:10811286-10811308 GTCAGGCCCGGGGTGGGTCGGGG + Intronic
1163569468 19:18072152-18072174 GCCAGGACCAAATTGGTTCGAGG + Exonic
1163776822 19:19223884-19223906 GCCAGGCACAGTGTGGGTCGAGG - Intronic
1164461944 19:28456444-28456466 GCCAGCTCCAGCGTGGGTGGGGG - Intergenic
1165862883 19:38918399-38918421 GTGAGGACCTGTGTGGGTGGTGG - Intronic
1165885662 19:39076506-39076528 GCCTGAACCAGTGTGGGTGAGGG + Intergenic
1166766912 19:45256605-45256627 GTCAGGACCAGTGGTGGTGGAGG + Intronic
1168585053 19:57585006-57585028 GCCAGGACCAGTGAGGGCCTGGG - Intronic
925144638 2:1572809-1572831 GCGTGGGCCAGTGTGGGTGGAGG - Intergenic
927509780 2:23637151-23637173 CCCAGGCCCAGTGTGGGACTTGG + Intronic
928099763 2:28429945-28429967 GCAAGCAACAGTGTGGGTTGTGG + Intergenic
929995978 2:46826443-46826465 GCCAGGAACAGGGTGGCTTGGGG + Intronic
932421339 2:71603235-71603257 CCAAGGACCAGTTTGGGTCCTGG + Intronic
932767986 2:74483147-74483169 GACAAGACCAGTGGGGGTCTAGG + Intronic
937390681 2:121483178-121483200 ACCAGGCCCTGTGTGGGGCGGGG - Intronic
938378946 2:130825944-130825966 GCCAGGGCCAGGCTGGGGCGGGG - Intergenic
940786284 2:157984844-157984866 CCCAGGTCTTGTGTGGGTCGGGG + Intronic
941005757 2:160245291-160245313 GCCAGGAGCAGAGTGAGTTGAGG - Intronic
947447151 2:230172766-230172788 GGCAGGACCTGTGAGCGTCGGGG - Intronic
948330442 2:237160448-237160470 GCCAAGACCAGGGTGGGGCAAGG + Intergenic
948384984 2:237575639-237575661 GCCAGGACCAGGGAGGGGCGGGG + Intronic
1170538694 20:17366467-17366489 GCCAGGCACAGTGTCGGTCCTGG - Intronic
1171023709 20:21609752-21609774 GCCATGACCACAGTGGGTTGGGG + Intergenic
1174524884 20:51163003-51163025 GCCAGCACAAATGTGGGCCGAGG + Intergenic
1175049172 20:56137339-56137361 TCCAGAACCAGTGTGGGTTCTGG - Intergenic
1175895301 20:62333313-62333335 GCCAGGCACAGTGGGGGTCCAGG + Intronic
1175919256 20:62442363-62442385 GCCAGGATCAGGGTTGGTTGGGG + Intergenic
1176166736 20:63678255-63678277 AGCAGGATCACTGTGGGTCGAGG - Exonic
1176384985 21:6134737-6134759 GCCAGGTCCTGTGGGGGACGGGG + Intergenic
1178598048 21:33972693-33972715 GCCAGGACTAGTGTGGCTGGGGG + Intergenic
1178893517 21:36540583-36540605 GCCAGGACCAGGGGGGTTTGAGG + Intronic
1178916436 21:36707963-36707985 GCCTGGCCCAGCGTGGGTTGGGG + Intronic
1179738488 21:43403515-43403537 GCCAGGTCCTGTGGGGGACGGGG - Intergenic
1179998537 21:44984918-44984940 GCCAGGCCCTGTGTGGGTGGGGG - Intergenic
1180613500 22:17112606-17112628 GCAAGGACCAGTGTGAGACTGGG - Exonic
1180722458 22:17919714-17919736 GCCAGGTCCAGGGCTGGTCGTGG - Intronic
1180847045 22:18989205-18989227 GCAAGAACCTGTCTGGGTCGGGG + Intergenic
1183300437 22:37056505-37056527 GACAGGACCAGTGTTTGTCATGG + Intronic
1183718748 22:39549947-39549969 GCCAGGCCCAGTTTGGGCCCTGG - Intergenic
1184597495 22:45523114-45523136 GCCAGGACCTGAATGGGGCGTGG + Intronic
1184630695 22:45775977-45775999 GACAGGTCAAGTGTGGGTCAAGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185110246 22:48896504-48896526 GGCAGGAGCAGAGGGGGTCGGGG + Intergenic
953576704 3:44118495-44118517 GCAAGGGCAAGTGTGGGTCTGGG - Intergenic
954037213 3:47857681-47857703 AGCAGGGCCAGGGTGGGTCGAGG - Intronic
954454135 3:50587944-50587966 GCCAGGACCACAGTGGGCCCAGG + Intergenic
961585854 3:127923188-127923210 GCCAGGACCAGTCTGTGGCAAGG - Exonic
968133894 3:196208263-196208285 GGGAGGACCAGTCTGGGACGAGG - Intronic
968662506 4:1804581-1804603 CCCAGGACCAGCGTGGGCCGAGG - Intronic
968735715 4:2295657-2295679 GGCAGGACCTGTGAGGGCCGAGG - Intronic
969761796 4:9190978-9191000 GCCAGCATCAATGTGGGTTGAGG - Intergenic
970169500 4:13275607-13275629 GCCAGGACCAGGGTGAGGCAAGG - Intergenic
975299410 4:72772217-72772239 GCCAGGAGCAGTGAGGATTGTGG + Intergenic
978377248 4:108087832-108087854 GGGAGGACCAGTCTTGGTCGTGG - Intronic
982398508 4:154940086-154940108 GCCAGGAACAGTGTAGGTGCAGG - Intergenic
988683021 5:33502207-33502229 GCCAGGACCAGTGTGGGTCGAGG + Intergenic
988913342 5:35868526-35868548 GCCATGACCAGTGTGGGTCCTGG + Intronic
992622930 5:78611283-78611305 GGCAAGACCAGTGTGGGCTGAGG + Intronic
1001537145 5:172506052-172506074 GCCAGGAGCATTGGGGGTGGGGG - Intergenic
1001803636 5:174564831-174564853 GCCAGGACAACTGTGAGACGTGG - Intergenic
1002162042 5:177320102-177320124 GGAAGCACCAGTGTTGGTCGGGG - Intergenic
1002174302 5:177392893-177392915 GCCAGGTGCAGTGTGGCTCATGG - Intronic
1002605579 5:180381064-180381086 GCCTGGCCCAGGGTGGGTGGAGG - Intergenic
1005584233 6:27260304-27260326 CCCAGGACCATTTAGGGTCGCGG + Intergenic
1005976591 6:30804840-30804862 CCTGTGACCAGTGTGGGTCGGGG - Intergenic
1007082032 6:39114666-39114688 ATCAGGACCTGCGTGGGTCGCGG + Intronic
1008393686 6:50982093-50982115 GCCAGGACAGGTGTGGGTTTGGG - Intergenic
1012248217 6:96951218-96951240 GCCAGGACCAGCTTGGGTTCAGG + Intronic
1017854526 6:158338733-158338755 GCCAGGACCAGAGAGGGACCAGG + Intronic
1019619855 7:1986575-1986597 GCCTGGAGCAGTGCGGGTGGAGG - Intronic
1020012804 7:4815772-4815794 GCCAGGGCCACTGTGGGGCGTGG - Intronic
1023367070 7:39475003-39475025 GCCAGGAGCTGTGGGGGCCGGGG - Intronic
1025235095 7:57228948-57228970 ACCAGGACCACTGTTGGTCCTGG + Intergenic
1026384262 7:69830221-69830243 ACCAGGAGCAGTGTGGGAGGAGG + Intronic
1028041394 7:86058717-86058739 GCAAGGAGCAGTGGGGGTGGGGG + Intergenic
1031860956 7:126979830-126979852 GCCAGAAGCAGTGTGGGACTTGG - Intronic
1034205073 7:149307992-149308014 GACAGGACCTGTGAGGGTCTGGG + Intergenic
1035073249 7:156159980-156160002 GCCAGGACCAGGGTGGGCTTTGG - Intergenic
1035119571 7:156555199-156555221 CCCAGGACCAGGGTGGGCCCAGG + Intergenic
1035431868 7:158828926-158828948 GCCTGGACCGGGGTGGGTGGGGG + Intronic
1036392447 8:8335709-8335731 GCCAGGAACAGGGTGGGGAGGGG - Intronic
1037365385 8:18116436-18116458 ACCAGGACCAGTGCTGGCCGTGG + Intergenic
1038135984 8:24786311-24786333 GCCAGGCCCTGTGTGGGTGGGGG + Intergenic
1040413014 8:47173476-47173498 GATAGGACCACTGTGGGTGGGGG + Intergenic
1045283107 8:100766533-100766555 GCCAGGAACAGAGTGGGGCCAGG - Intergenic
1045506057 8:102779572-102779594 GCCAGGTGCTGTGTGGGTTGAGG - Intergenic
1049425896 8:142537737-142537759 CCCAGGACCTGTGCGTGTCGTGG - Intronic
1053141061 9:35682991-35683013 GCCAGTGCCAGAGTGGGTGGTGG + Intronic
1053214302 9:36258179-36258201 GCCGGGTCCAGTGTGGGCCTCGG + Intronic
1056533076 9:87504451-87504473 GCCAGGAACAGAGTAGGTGGAGG + Intronic
1060214496 9:121730531-121730553 CCCTGGGCCAGTGTGGGTCCAGG + Intronic
1061188917 9:129070637-129070659 GCCAGGACCAGTGGGGCCTGTGG + Exonic
1062264570 9:135681160-135681182 GCCAGGACCAGTGTGCTCTGTGG + Intergenic
1062335899 9:136067302-136067324 GCCGGGAGCAGTGGGGGTGGGGG + Intronic
1062450080 9:136611486-136611508 GGCAGGCCCAGTGTGGGGCTTGG + Intergenic
1062711207 9:137976091-137976113 GCCATGCCCAGTGTGGGCTGGGG + Intronic
1062715944 9:138010134-138010156 GCCAGGAAGAGTCTGGGTCCTGG + Intronic
1189860228 X:45264135-45264157 GCCAGGACCAGAGTGAGACAAGG - Intergenic
1192149418 X:68702971-68702993 GCCAGGACCAGGGGCGGTGGTGG + Intronic
1194447121 X:94002099-94002121 CCGAGGACCAGTGTTGGTCGTGG - Intergenic
1197514618 X:127410839-127410861 GCCTGGGCCAGTGGTGGTCGTGG - Intergenic
1201340468 Y:12927376-12927398 GCCAGGAGCAATCTGGGTAGGGG + Intergenic
1202366779 Y:24171077-24171099 GCCAGGACCAGTGGGGAGCTGGG + Intergenic
1202504003 Y:25499046-25499068 GCCAGGACCAGTGGGGAGCTGGG - Intergenic