ID: 988684846

View in Genome Browser
Species Human (GRCh38)
Location 5:33516186-33516208
Sequence GGTCTCACTCAACAAGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988684846_988684852 12 Left 988684846 5:33516186-33516208 CCACTCACTTGTTGAGTGAGACC No data
Right 988684852 5:33516221-33516243 GATTGCAATGTCACAGTAGGTGG No data
988684846_988684851 9 Left 988684846 5:33516186-33516208 CCACTCACTTGTTGAGTGAGACC No data
Right 988684851 5:33516218-33516240 GGAGATTGCAATGTCACAGTAGG No data
988684846_988684853 20 Left 988684846 5:33516186-33516208 CCACTCACTTGTTGAGTGAGACC No data
Right 988684853 5:33516229-33516251 TGTCACAGTAGGTGGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988684846 Original CRISPR GGTCTCACTCAACAAGTGAG TGG (reversed) Intergenic