ID: 988684846 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:33516186-33516208 |
| Sequence | GGTCTCACTCAACAAGTGAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 988684846_988684852 | 12 | Left | 988684846 | 5:33516186-33516208 | CCACTCACTTGTTGAGTGAGACC | No data | ||
| Right | 988684852 | 5:33516221-33516243 | GATTGCAATGTCACAGTAGGTGG | No data | ||||
| 988684846_988684851 | 9 | Left | 988684846 | 5:33516186-33516208 | CCACTCACTTGTTGAGTGAGACC | No data | ||
| Right | 988684851 | 5:33516218-33516240 | GGAGATTGCAATGTCACAGTAGG | No data | ||||
| 988684846_988684853 | 20 | Left | 988684846 | 5:33516186-33516208 | CCACTCACTTGTTGAGTGAGACC | No data | ||
| Right | 988684853 | 5:33516229-33516251 | TGTCACAGTAGGTGGTCAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 988684846 | Original CRISPR | GGTCTCACTCAACAAGTGAG TGG (reversed) | Intergenic | ||