ID: 988687537

View in Genome Browser
Species Human (GRCh38)
Location 5:33539581-33539603
Sequence CTGTGGGTCTTGAGTTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988687537_988687543 10 Left 988687537 5:33539581-33539603 CCTTCTCAACTCAAGACCCACAG 0: 1
1: 0
2: 2
3: 19
4: 255
Right 988687543 5:33539614-33539636 TCAACTTTTAGCAGACTTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 126
988687537_988687544 20 Left 988687537 5:33539581-33539603 CCTTCTCAACTCAAGACCCACAG 0: 1
1: 0
2: 2
3: 19
4: 255
Right 988687544 5:33539624-33539646 GCAGACTTAGAGGTATTCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988687537 Original CRISPR CTGTGGGTCTTGAGTTGAGA AGG (reversed) Intronic
900212351 1:1462345-1462367 CTGTGGGTGCTGAGTGGACAGGG + Intronic
900805823 1:4767758-4767780 CTGTGCTTCTTGTGATGAGAAGG - Intronic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901367942 1:8769958-8769980 CTTTGTGTTTTTAGTTGAGATGG + Intronic
901536019 1:9883443-9883465 CTGTGGGGCCTGAGTAGACATGG - Intronic
901893239 1:12286246-12286268 CTTTGTGTTTTTAGTTGAGATGG + Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903137506 1:21318982-21319004 CTGTGGGTTTTCAGTGGAGCTGG + Intronic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905917973 1:41699053-41699075 CTGTGAGTTTTGGGTTCAGAAGG - Intronic
906547884 1:46634670-46634692 CTGGGGGCCTTGGGTTCAGAAGG + Exonic
906795002 1:48689684-48689706 CTGTGTGTGTTGGGATGAGATGG + Intronic
908106708 1:60852025-60852047 CTGTGTGTGTTGAGTTGTGTTGG + Intergenic
908897928 1:68922178-68922200 CTGAGTGTCTTTAATTGAGAAGG + Intergenic
911464332 1:98233137-98233159 CAGTGGGTCTTAACTTGTGAGGG - Intergenic
912736185 1:112151500-112151522 GTATGGGTCTTGAGTTCAGAAGG + Intergenic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
915253086 1:154604414-154604436 CAGTGGGCCTTGGGTGGAGAAGG - Intronic
916126466 1:161575905-161575927 CTTTGGGTCTTCATTTCAGAAGG - Intergenic
916136385 1:161657745-161657767 CTTTGGGTCTTCATTTCAGAAGG - Intronic
919041783 1:192398271-192398293 CTTTGGGTCTTCATTTCAGAAGG - Intergenic
919915256 1:202135026-202135048 CTGTGGCTCTTGGGTAGAAAAGG - Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922865085 1:228852754-228852776 CTGGGGGCCATGAGTTGAGATGG + Intergenic
923024928 1:230196598-230196620 GTGTGGGTCTTGACAGGAGATGG + Intronic
923526801 1:234778966-234778988 CTGTGTGTCTTGACTTGAGATGG + Intergenic
1065516049 10:26525345-26525367 CTTTGGGTCTTGATTTCTGAAGG + Intronic
1065705282 10:28466605-28466627 GTGTGTGTTTTGAGTAGAGACGG - Intergenic
1066239399 10:33518479-33518501 TTGTGTGTCTTTAGTAGAGATGG - Intergenic
1066746283 10:38605631-38605653 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1071044391 10:81355971-81355993 CTGTGGTGGCTGAGTTGAGAGGG - Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1071786439 10:88905565-88905587 CTTTAGGTCTGGAGTAGAGATGG + Exonic
1073312240 10:102551313-102551335 CTGTGGGGCTCCAGTTGAGTTGG + Intronic
1074971203 10:118540697-118540719 CTGTAAGTCTTGATTTGAGGAGG - Intergenic
1077126004 11:937188-937210 TTTTGGATCTTGAGTAGAGACGG + Intronic
1077616274 11:3676285-3676307 CTGAGGGTCTGGTGTTGAGTCGG + Exonic
1077660012 11:4059395-4059417 CTGTGAGTCTTGTGTTGAGAAGG + Exonic
1078317413 11:10304917-10304939 CTTTGGGGCTGGAGTTGGGATGG - Intronic
1078397275 11:10992282-10992304 GTGTGTGTCTTCAGTAGAGACGG + Intergenic
1078570438 11:12453118-12453140 CTCTGGGGTTTGAGTTGAGATGG + Intronic
1083808788 11:65090715-65090737 CTGTGGGTCTTGGGCTGACCTGG - Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1085771088 11:79326478-79326500 CTGTGGGTCTTTAGGCGAGGGGG - Intronic
1089843629 11:121440853-121440875 CTTTGGGTCTTGATTTCTGAAGG + Intergenic
1090593245 11:128294062-128294084 CTGTGGTCCTTGCGGTGAGAGGG - Intergenic
1091949490 12:4581075-4581097 CTTTGGGTCTTGGTGTGAGAGGG + Intronic
1092387212 12:8044957-8044979 CGGTGAGTCTGGAGTTGGGATGG + Exonic
1092874555 12:12836773-12836795 CTGTGTGTCTTCAGATAAGAAGG - Intergenic
1095735148 12:45548103-45548125 CTAAGGGTCTTGAGATGGGAAGG + Intergenic
1095937026 12:47695524-47695546 TTCTGGTTCTTAAGTTGAGAGGG + Intronic
1096039761 12:48503619-48503641 CTGTAGGTCTTGACATCAGATGG - Intergenic
1096357348 12:50952548-50952570 CTGTGGCTCTTGAGGTGGGTCGG - Intergenic
1097334362 12:58365803-58365825 CTTTGGATCTTGTGTTGGGATGG - Intergenic
1100854299 12:98745510-98745532 CTGAGAGGCGTGAGTTGAGATGG - Intronic
1101976302 12:109362526-109362548 CTGTGGGTCTTCATTTCTGAAGG - Intronic
1102058438 12:109914220-109914242 TTGTGTGTCTTGGGTTGCGAGGG + Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1103136190 12:118509934-118509956 CTGTTGGACTTGGGCTGAGAGGG + Intergenic
1103776624 12:123371158-123371180 GTGTGGGTTTTTAGTAGAGACGG - Intergenic
1104365876 12:128176428-128176450 CTGTGTCTCTTAATTTGAGAAGG - Intergenic
1104700225 12:130897358-130897380 GTGTGTGTCTTTAGTGGAGACGG - Intergenic
1105547503 13:21361627-21361649 GTGTGTGACTTGAGCTGAGAAGG + Intergenic
1105580733 13:21693361-21693383 CTGTGGGTATTGGGTGGACATGG + Intronic
1106459804 13:29958983-29959005 CAATGTGTCTTGAGTTGGGAAGG + Intergenic
1106775962 13:33010161-33010183 CAGTGGTTCCTGAGTTGAGTTGG + Intergenic
1106891314 13:34248987-34249009 CTGTGGGGTATGAGTTGAAAAGG - Intergenic
1107952274 13:45474332-45474354 TTGTGTGTTTTTAGTTGAGACGG + Intronic
1108837585 13:54571194-54571216 ATTTGGGTCTTGAGCTCAGAGGG + Intergenic
1110735133 13:78927770-78927792 CTGTGGGTCTTGGGCAGATAGGG - Intergenic
1111378095 13:87407574-87407596 CTAAGGGTTTTGAGATGAGAAGG - Intergenic
1112223371 13:97513874-97513896 GCCTGGGTGTTGAGTTGAGAGGG + Intergenic
1112473122 13:99707442-99707464 TTGTGTGTCTTTAGTAGAGACGG + Intronic
1114683570 14:24507078-24507100 CCGTGTGTCTTGAGTTGGGTAGG + Intronic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117939883 14:60951814-60951836 CTGTGGGTCTTGGATCGTGAAGG + Intronic
1120374083 14:83678114-83678136 CTGTGTGTTTTTAGTAGAGACGG - Intergenic
1121135496 14:91494079-91494101 TTGTGTGTCTTTAGTAGAGACGG - Intronic
1121135546 14:91494690-91494712 TTGTGTGTCTTTAGTAGAGATGG - Intronic
1125063829 15:35457948-35457970 CTGTGGATTTTGATTTGAGGGGG - Intronic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1126322327 15:47438341-47438363 CTGTGGCTGCTGTGTTGAGATGG - Intronic
1131070547 15:89463048-89463070 CTGAGGGTCCTGAGTTGGAAAGG - Intergenic
1136344630 16:29666767-29666789 CTGTGGGGCCTGGGTGGAGAGGG + Exonic
1136736778 16:32474011-32474033 CTGCGGGTCTTGGGGTGAGATGG - Intergenic
1137627825 16:49920787-49920809 CAGTGGGTCTTGTGCTGAGAAGG + Intergenic
1139204886 16:65018155-65018177 CTTGGGTTCTTGAGTGGAGAAGG - Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141106631 16:81239185-81239207 CTGTGTGTTTTTAGTAGAGACGG + Intronic
1141596722 16:85101454-85101476 CTGTGGGTCTGGGGTTGATGGGG - Intronic
1141610058 16:85176254-85176276 CTGTGGGTCTGCAGTTGTGGAGG + Intronic
1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1144161587 17:12565833-12565855 CTTTGGGTCTTGAGCTGTGTGGG + Intergenic
1145207364 17:20991739-20991761 CTGTGTGTCTTGGGTTGGAAGGG + Intergenic
1146156868 17:30531680-30531702 TAGTGGGTCTTGAGTAGAGTAGG + Intergenic
1146973665 17:37093021-37093043 CTATGGGCCTGGAGCTGAGATGG - Intronic
1147811787 17:43175776-43175798 CTGTGAGGCTAGGGTTGAGAAGG - Exonic
1149141242 17:53435747-53435769 CTGTGGTTGTTGAGATGAGATGG + Intergenic
1149911018 17:60566809-60566831 CTGTGGGTCATAAATTGGGAAGG - Intronic
1152671309 17:81608919-81608941 CTGTGGGCCTTGACTTGCCAAGG - Intronic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1153183177 18:2459054-2459076 CTGTGGGCCTTGAGCTGTGCTGG - Intergenic
1153306153 18:3632923-3632945 TTTTGTGTTTTGAGTTGAGATGG + Intronic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1156122116 18:33858041-33858063 CCTTGCCTCTTGAGTTGAGATGG - Intronic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1158843303 18:61411829-61411851 CTTTGGGACTTGGGTGGAGAGGG + Intronic
1158865667 18:61635783-61635805 CTTTGGGTCTTCATTTGTGAAGG + Intergenic
1159985407 18:74835419-74835441 CTGAGGGTGTGCAGTTGAGATGG + Intronic
1160335093 18:78031627-78031649 CTGTGGGGCCTGATTAGAGAGGG - Intergenic
1160488993 18:79320803-79320825 CTGTGGGTTTTACGTTGGGAGGG + Intronic
1161736111 19:5992965-5992987 CTCTGGGTCTTGAGTGGGGCAGG + Intergenic
1162563541 19:11432148-11432170 CTGTGGGACTTGAGTATGGAAGG - Intronic
1162927103 19:13936179-13936201 CTGTGGCTTTTGAGTAGGGATGG - Intronic
1163252824 19:16136417-16136439 CCGTGGGTCTTGAGTGGTGCTGG - Intronic
1164408390 19:27975568-27975590 CTGTGGGACTTGAGTTACCAAGG + Intergenic
1164761176 19:30729457-30729479 CTGTTGGTCTTGAGTGTGGACGG + Intergenic
1166722362 19:45004086-45004108 CTTTGTGTCTTTAGTAGAGATGG + Intronic
1166964216 19:46518296-46518318 TTGTGTGTCTTTAGTAGAGATGG + Intronic
1167754233 19:51401472-51401494 TTGTGTGTCTTTAGTAGAGATGG + Intergenic
1168141931 19:54393886-54393908 CTGTGTGTTTTTAGTAGAGACGG - Intergenic
925522793 2:4766360-4766382 CTGTGGTTCTAGAATTGAGATGG + Intergenic
926861064 2:17309309-17309331 CTCTGGGTCTTCAGTTGCTAAGG - Intergenic
929289357 2:40171556-40171578 ATGTGGGTTTTGAGTAGAAAAGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
930605682 2:53490728-53490750 CTGTGGAGCTTGTGCTGAGAGGG - Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932686233 2:73872727-73872749 CTGTGGGACTTGAATTTAGTAGG - Intronic
933711714 2:85331256-85331278 TTGTGGGTTTTGTTTTGAGATGG + Intergenic
934308684 2:91844819-91844841 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
935960861 2:108424248-108424270 ATGTGGGTGTTGCCTTGAGAAGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937531611 2:122835872-122835894 TTTTGGGTTTTTAGTTGAGATGG + Intergenic
937835754 2:126468939-126468961 CTGTGTGTCCTGAGAAGAGAGGG - Intergenic
941721291 2:168815941-168815963 GTCTTGGTCATGAGTTGAGATGG - Intronic
944944853 2:204671808-204671830 CTGTGGGTCTTTATTTTAGCTGG - Intronic
944958328 2:204838383-204838405 GTGTGTGTCTTTAGTAGAGACGG + Intronic
945854584 2:215053541-215053563 CTGTGGGTCTTTGGCTGAGTAGG - Intronic
945923452 2:215779669-215779691 AAGTGGGACTTGAGTTGAGCAGG - Intergenic
946389232 2:219405407-219405429 CTGGGGATCTTTAGTTGGGAAGG + Intergenic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
948426072 2:237887150-237887172 CTGTGGGTCCTGTGTGGGGAGGG + Intronic
948532234 2:238616617-238616639 CTGAGGGTCTTGAAGTGAGGAGG + Intergenic
1172739235 20:37152467-37152489 CGGAGGGTCTTGAGCAGAGAAGG + Intronic
1173020320 20:39261815-39261837 TTGTGTGTCTTTAGTAGAGATGG + Intergenic
1173594198 20:44248066-44248088 CTCCGTGTCTTGAGCTGAGAAGG + Intronic
1173810497 20:45952391-45952413 CAGTGGGTCTTGGCTGGAGATGG + Exonic
1174807739 20:53618962-53618984 TTGTGTGTCTTTAGTAGAGATGG - Intergenic
1174859640 20:54078633-54078655 CTGTGGTTCTAGAGCTGAGGTGG - Intergenic
1176317098 21:5256763-5256785 CTGAGGGTCCTGATTTTAGAGGG - Intergenic
1177564773 21:22806107-22806129 CTGTAGGGCCTCAGTTGAGATGG - Intergenic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179462250 21:41544434-41544456 CTGTGGGTCTTTATTTCTGAAGG + Intergenic
1180621632 22:17166472-17166494 CTGTGGTTCTTGCCTTCAGAAGG - Intergenic
1181261666 22:21602494-21602516 CTCTGGGTCTTTACTTGGGAAGG + Intronic
1181934768 22:26430135-26430157 CTCTGGCTCCTGAGTGGAGAGGG + Intronic
1182803880 22:33054233-33054255 CTGTGAGTCTGGAGTCGAGGAGG - Intronic
1183809286 22:40240398-40240420 CTGTGTGTCTTGACCTGAAAAGG - Intronic
1184085485 22:42260498-42260520 GTATGGTTCTTGAGATGAGAGGG + Intronic
950918487 3:16668964-16668986 CTGTGGGTTTGGAGTTGGCAGGG + Intronic
952201029 3:31127788-31127810 CTTTGGGTCTTCATTTGTGAAGG - Intergenic
953493995 3:43371171-43371193 CTGTAGGTCTTGGTTTGGGACGG - Intronic
954476196 3:50748307-50748329 CTGTGGTTTCTGAGTTTAGAGGG + Intronic
954744270 3:52778159-52778181 CTGTGGGATATGAGGTGAGATGG - Intronic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
959836642 3:110925578-110925600 CATTGGGTCTTGAATGGAGAAGG - Intergenic
960327504 3:116315357-116315379 CTGTGGGTCTCAATTTAAGAGGG - Intronic
961772484 3:129260194-129260216 CTCTGTGTCTTGGGTTGGGATGG + Intronic
963565777 3:146928484-146928506 CTGTGGTTCTTGAGCAGAGCAGG + Intergenic
965620945 3:170641839-170641861 CTGTGGAATTTGAGTTGAGGTGG + Intronic
969368010 4:6710794-6710816 CTGTGGCACTTGTGTTAAGAAGG - Intergenic
970279599 4:14439855-14439877 ATGTGGGCCTTGATTTGAAAAGG + Intergenic
972709166 4:41577072-41577094 CTGTGGGACTTGAGTACACATGG + Intronic
972916784 4:43891449-43891471 CTTTGGGTCTTCATTTGTGAAGG + Intergenic
973536168 4:51884654-51884676 CTCTTGCTCTTGAGTTTAGAGGG + Intronic
976611866 4:87038979-87039001 CTGTGGGCCGTGAGTTGCCATGG + Intronic
976959986 4:90958529-90958551 CTGTGTGTTTTGGGTCGAGAAGG + Intronic
977597698 4:98901692-98901714 GTGTGAGTCTTGAGTTCAAAAGG - Intronic
978561896 4:110042494-110042516 GTCTGGCTCTTGAGTTGAGGGGG + Intergenic
980646628 4:135651683-135651705 CTGTGTTGCTTGGGTTGAGAGGG - Intergenic
980989448 4:139726530-139726552 CTGTGGGGACTGAGTTGAAAGGG + Intronic
982167387 4:152626897-152626919 CTGTGGGCCATGAGTTGAAAAGG + Exonic
982735265 4:158999625-158999647 CTGGGTGTCTTAAGTAGAGAAGG - Intronic
982774392 4:159427263-159427285 CTGGGGGTCTTCAGGTGTGATGG - Intergenic
983381942 4:167006869-167006891 CTGAGAGTTTTGAGTTGCGAGGG - Intronic
984270428 4:177542613-177542635 GTGTGTGTCTTTAGTAGAGACGG - Intergenic
986289206 5:6385312-6385334 CTGCTGGTCTTGAGCAGAGAAGG - Intergenic
987835574 5:23156616-23156638 CTGTGGGTCTTCATTTCTGAAGG + Intergenic
988672653 5:33398384-33398406 CTGTGTGTCTTTACTTGGGAAGG + Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
990682488 5:58260837-58260859 GTGTGTGTCTTTAGTAGAGACGG - Intergenic
991227844 5:64293096-64293118 CAGTGGGTCTTAACTTGTGAGGG + Intronic
993680059 5:90866008-90866030 CTGTGGTTCTTTAGCTAAGAGGG + Intronic
995083977 5:108086449-108086471 TTGTGGGTCTTGATTTCTGAAGG + Intronic
995523935 5:113035724-113035746 CTCTGGGACATGAGTTTAGATGG - Intronic
997720840 5:136077398-136077420 CTGAGGCTCTTGAATTAAGATGG + Intergenic
997921418 5:137982755-137982777 CTGTGGGTCTTGATTTCTGAAGG + Intronic
998245027 5:140493063-140493085 CTGTGGTTCTTTCTTTGAGACGG + Intronic
999463245 5:151774959-151774981 CTGTCTGTCTTTAGTTGGGAAGG + Intronic
999579662 5:153022720-153022742 CTCTGGGTTTTGTTTTGAGATGG - Intergenic
1000015925 5:157276367-157276389 CTGTGTGTATTGAGATGATATGG + Intronic
1000863432 5:166484481-166484503 ATGCGAGGCTTGAGTTGAGATGG + Intergenic
1001375099 5:171248813-171248835 CTTTGGGTCTTGAGTGGTGCAGG - Intronic
1001711804 5:173784773-173784795 CTGTGGGAGATGAGTAGAGATGG + Intergenic
1003404175 6:5815056-5815078 ATGTGTGACTTGAGCTGAGAAGG - Intergenic
1004410327 6:15375576-15375598 CTGTGGGTCTCCAGCAGAGAGGG + Intronic
1005601158 6:27427635-27427657 ATGTGGGTCTTGAGCTCAGGAGG - Intergenic
1006313052 6:33274889-33274911 CTTTGGTTCATGAGTTCAGATGG + Intronic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1007826521 6:44605109-44605131 CCCTGGGTCTTGAGTTTGGAAGG + Intergenic
1011123898 6:83985924-83985946 CTGTGGGTCTTGACTTCATGTGG - Intergenic
1011262463 6:85483672-85483694 CTGTGGTTATTGAGCTGAAAGGG + Intronic
1011294681 6:85813287-85813309 CTGTGTGTCCTGGGTTGATAGGG + Intergenic
1016291916 6:142536529-142536551 CTTTGGGACTGGACTTGAGAGGG - Intergenic
1016676167 6:146771233-146771255 CTCTGGGTCTTCAGCTGTGAAGG + Intronic
1018179744 6:161211924-161211946 CTCTGGGCCTTGAGTTGAAATGG - Intronic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1018341928 6:162859844-162859866 CTTTGGGTCTTAATTTCAGAAGG + Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019708217 7:2506547-2506569 TTAAGGATCTTGAGTTGAGAGGG + Intergenic
1019795589 7:3045809-3045831 CTGTGGGTCTTGGTGTTAGAAGG - Intergenic
1019951684 7:4378310-4378332 CTGTGGGTCATGAATTCAGGAGG + Intergenic
1024754406 7:52512733-52512755 CTGTGGGTGATGTGATGAGAGGG - Intergenic
1028493303 7:91438181-91438203 ATGTAGGTTTAGAGTTGAGAGGG + Intergenic
1028551910 7:92077739-92077761 ATGTTGGTCTTGAGTAGACATGG - Exonic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1031522704 7:122785832-122785854 GTGTGGGGCTTGAGGTGGGAGGG - Intronic
1032494030 7:132347622-132347644 CTGAGGGTCTAGTGTTGAGTAGG + Intronic
1032806740 7:135362810-135362832 CTGTGGGTGGTGGGCTGAGAGGG + Exonic
1034270556 7:149801695-149801717 CTTTGGCTCTTGGCTTGAGAAGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1039491956 8:37954467-37954489 CAGTGTGTCTTGAGTTCTGAAGG + Intergenic
1039900818 8:41751497-41751519 CAGTGGCTGTTGAGCTGAGATGG + Intronic
1040514083 8:48120291-48120313 TTCGGGGTCTTGAGCTGAGAAGG + Intergenic
1042704854 8:71655253-71655275 CTGCTGTTCTTGAGCTGAGAGGG + Intergenic
1043418130 8:80072135-80072157 CTTTGTGTTTTTAGTTGAGACGG - Intronic
1044881915 8:96731715-96731737 CTGGGGGTGTTGAGGTGGGAAGG + Intronic
1046383600 8:113480769-113480791 CTGAGGGTCCTGAGTTGGAAAGG + Intergenic
1049150680 8:141033489-141033511 CTCTGGGTCTTGAGTTTCCATGG + Intergenic
1049274299 8:141711992-141712014 CTGTGGGTCTCGAGGTGATGGGG + Intergenic
1049702512 8:144021589-144021611 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049702719 8:144022436-144022458 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1051901025 9:22040465-22040487 ATGTGGGTGGTGGGTTGAGAAGG + Intergenic
1055014036 9:71596434-71596456 CTGAGGGTCCTGACTTTAGAAGG + Intergenic
1055509264 9:76979090-76979112 TTGTGTGTCTTTAGTAGAGATGG - Intergenic
1057014364 9:91638086-91638108 CTGTGGAATTAGAGTTGAGATGG + Intronic
1057140113 9:92721581-92721603 CTGTGGGTCTTGGGTCGGAAGGG + Intronic
1057576373 9:96245810-96245832 CTGTGGGTCCTGAGTCCAAAGGG - Intronic
1058966713 9:110045738-110045760 TTGTAGGTTTTTAGTTGAGATGG + Intronic
1061156147 9:128862997-128863019 TTGTGTGTCTTTAGTAGAGATGG + Intronic
1061823263 9:133240217-133240239 CTGTGTGTGTTTAGTAGAGACGG - Intergenic
1062398616 9:136362851-136362873 CTGTGTGTCTTGTATTGATAAGG + Intronic
1203415363 Un_KI270582v1:1811-1833 CTGAGGGTCCTGATTTTAGAAGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186930349 X:14382493-14382515 CTGTGAGTCTTCCTTTGAGATGG + Intergenic
1187734701 X:22291960-22291982 TTGTGGGTTTTGAGCAGAGAAGG - Intergenic
1188508488 X:30908862-30908884 CTGTGTGTCCTGGGTTGAGGAGG + Intronic
1188771848 X:34162847-34162869 ATGTGGGTCTTGAGTCCATAAGG + Intergenic
1188784756 X:34332066-34332088 CTGTGTGTGTTTAGTGGAGATGG - Intergenic
1192231998 X:69271845-69271867 CTGAGAGTCTTGAGAGGAGAAGG - Intergenic
1193730530 X:85097205-85097227 CTGTGGGACTTGAGTAGGCATGG + Intronic
1195836392 X:109119401-109119423 CTGAGGGTGTTGAGATGTGATGG - Intergenic
1197705111 X:129629349-129629371 CTGTGGGACTTGAGTATACATGG + Intergenic
1197760720 X:130025952-130025974 TTGTTGGACCTGAGTTGAGAAGG + Intronic
1198086645 X:133288579-133288601 CTGTGGGAGTTGAATTGAGCTGG + Intergenic
1198156057 X:133961906-133961928 CTCTGGGACTTGGGTGGAGAAGG - Intronic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic