ID: 988688381

View in Genome Browser
Species Human (GRCh38)
Location 5:33547966-33547988
Sequence CAGGGGAAGGAGGATGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1865
Summary {0: 1, 1: 0, 2: 11, 3: 174, 4: 1679}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988688373_988688381 16 Left 988688373 5:33547927-33547949 CCTGGGAGTAGCAGGCACTTCAT 0: 1
1: 0
2: 2
3: 11
4: 173
Right 988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG 0: 1
1: 0
2: 11
3: 174
4: 1679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988688381 Original CRISPR CAGGGGAAGGAGGATGAAGA GGG Intronic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900377437 1:2362320-2362342 GAGGAGGAGGAGGAAGAAGAGGG + Intronic
900501877 1:3009979-3010001 CAGGGAAAGCTGGTTGAAGAAGG + Intergenic
900507899 1:3038806-3038828 CAGGGGCTGGAGGCTGAAGGAGG + Intergenic
900700803 1:4047556-4047578 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
900816748 1:4853215-4853237 CAGGGGGAGGAGGATAAAGGAGG - Intergenic
900836317 1:5007170-5007192 GAGGGGAAGGAGGTGGTAGAAGG - Intergenic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
901295462 1:8157798-8157820 GAGGAGGAGGAGGAAGAAGAAGG + Intergenic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901668686 1:10841285-10841307 CAGGTGCAGAAGGATGAAAAGGG - Intergenic
902069838 1:13724833-13724855 AAAAGGAAGGAGGAGGAAGAGGG + Intronic
902091766 1:13909373-13909395 CAGGGGCAAGAGGGTGAGGAGGG + Intergenic
902219884 1:14958097-14958119 CAGGGGAGGGAGCAGGCAGAGGG - Intronic
902221933 1:14971907-14971929 CAGGGGAAGGAGGACGAGACTGG - Intronic
902653850 1:17854113-17854135 CAGGGAGGGGAGGATGAAGAGGG - Intergenic
902955648 1:19922795-19922817 CAGGGGAAGTTGGCTGCAGAGGG - Intronic
903063600 1:20686138-20686160 GAGGGGATGGAGGAGAAAGAAGG + Intronic
903180161 1:21601353-21601375 CAGGGTTGGGGGGATGAAGAGGG - Intronic
903220956 1:21869506-21869528 GAGGAGGAGGAGGAAGAAGAAGG + Intronic
903368373 1:22818703-22818725 CAGGGGAGGGAAGAGAAAGAGGG - Intronic
903377117 1:22873768-22873790 CAGTGGAAGGAGGGTGAGAAGGG + Intronic
903624335 1:24720345-24720367 CAAGGGAGGGAGGATGGAGTTGG - Intergenic
903989199 1:27253435-27253457 AAGAGGAAGGAGGAGGAAGGAGG - Intronic
904008998 1:27379454-27379476 AGGGGAAAGGAGGATGCAGAGGG - Exonic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904087190 1:27917127-27917149 AAGGGGAAGGAGGAAGGAGAAGG - Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904321558 1:29700966-29700988 GAGGGGTAGGAGGAAGAAGAGGG + Intergenic
904376832 1:30086840-30086862 CAGGGGAAAGACGATGAGAAGGG + Intergenic
904462255 1:30687023-30687045 CAGGCAAAGGAGGCTGAGGAGGG - Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
904703642 1:32374544-32374566 CAGGAGAAGGAGGTACAAGAAGG - Intronic
904713714 1:32450832-32450854 GAGGAGTAGGAGGAGGAAGAGGG - Intergenic
904797849 1:33070858-33070880 AAGGAGGAGGAAGATGAAGAAGG + Intronic
904848825 1:33441508-33441530 GAAGGGGAGGAGGAGGAAGAAGG - Intergenic
904973948 1:34441733-34441755 CAGGGGAGGGAAGATGGAGGTGG + Intergenic
905173467 1:36122745-36122767 CTGGGGAACAAGGATGAAGGGGG - Intronic
905321258 1:37119090-37119112 CAGGGGAAGAAGGGACAAGAGGG + Intergenic
905575873 1:39044234-39044256 AAGGAGAAGGCGGAAGAAGAAGG + Intergenic
905580741 1:39081516-39081538 GAGCCGAAGGAGGAAGAAGACGG - Intronic
905912925 1:41666042-41666064 ATGGGGATGGAGGATGGAGAGGG - Intronic
905914682 1:41676421-41676443 CAGGAGAAGGTGGAAGAACAGGG + Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906636509 1:47413923-47413945 CAGGGTGGGGAGGTTGAAGAGGG + Intergenic
906958597 1:50398881-50398903 CAGGAGGAGGAGGAAGATGAAGG - Intergenic
907178923 1:52553117-52553139 GAGGGGGAGGAGGAGGGAGAGGG + Intronic
907223961 1:52927647-52927669 AAAGGGAAGGAGGAAGCAGAAGG - Intronic
907362003 1:53925163-53925185 AAGTTGAAGGAGGAAGAAGAGGG - Intronic
907389192 1:54145744-54145766 CAGGGGAAGTAGTAAAAAGAGGG + Intronic
907401138 1:54225675-54225697 CAGGGGAGGGAGGAAGGAGAAGG + Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907951748 1:59189897-59189919 CAGGGAAAGAAGAATGGAGAGGG - Intergenic
908023697 1:59926091-59926113 CAAGGGAAGGAGGTTGAAGCTGG + Intronic
908166411 1:61463472-61463494 TAGGAGGAGGAGGAGGAAGAGGG - Intergenic
908474270 1:64472231-64472253 GAGGAGGAGGAGGAAGAAGAAGG - Intronic
908501586 1:64748379-64748401 CAAGGGAAGTAGCATGCAGAAGG - Intronic
908820672 1:68083074-68083096 CAGGAGAGGGAGAATGAAAAAGG + Intergenic
908843052 1:68297830-68297852 CAGGGGAAGGGGGCTGAGGTGGG - Intergenic
908979591 1:69939477-69939499 GAGGGGCTGGAGGAGGAAGAGGG - Intronic
909170051 1:72283056-72283078 CAGGGGACTGGGGATGGAGAAGG + Intergenic
909590707 1:77346139-77346161 GAGGAGGAGGAGGAAGAAGAGGG + Intronic
909594795 1:77394417-77394439 AGAGGGAAGGAGGATTAAGAAGG - Intronic
909622418 1:77683201-77683223 CGGGGGAGGGAGAATGAAGGGGG - Intronic
909949594 1:81704100-81704122 GAGGGGAAGTATGATGATGAAGG - Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
911091366 1:94019780-94019802 CAGGGAGAGGGCGATGAAGAGGG + Intronic
911094379 1:94043993-94044015 AAGGGGAAGGAGGAAGGAAAGGG - Intronic
911482920 1:98466844-98466866 GAGGAGAAGGAAGAAGAAGAAGG + Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
911694406 1:100872691-100872713 GAGGAGAAGGAGGAATAAGAGGG + Exonic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912743896 1:112228594-112228616 GAGGGGAAGGGAGATGAAGGGGG + Intergenic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
912867587 1:113271787-113271809 AATGTGAAGGAGGAAGAAGATGG - Intergenic
913076432 1:115344204-115344226 CAGGTGAAGGAGTAGGGAGAAGG - Intergenic
913097673 1:115534835-115534857 AAGGGGATGGAGTAGGAAGAAGG - Intergenic
913380077 1:118201137-118201159 GAGGGGGAGGAGGAAGGAGACGG - Intergenic
913387554 1:118276083-118276105 CAGGGAAAGGAGGAGACAGAAGG + Intergenic
913409482 1:118535458-118535480 CAGGTGAAGAAGGACGAAGTTGG + Intergenic
913415230 1:118598048-118598070 CAGGAGAAAGAAGATGAAAAGGG + Intergenic
914316128 1:146513545-146513567 TGGGGGAAGGGGGATGAACAAGG - Intergenic
914498227 1:148219816-148219838 TGGGGGAAGGGGGATGAACAAGG + Intergenic
914559888 1:148808125-148808147 CACGGGGAGGAGGATGAAACCGG + Intergenic
914612945 1:149322090-149322112 CACGGGGAGGAGGATGAAACCGG - Intergenic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915018141 1:152755936-152755958 GAGGAGGAGGAGGAAGAAGAGGG - Intronic
915022051 1:152788192-152788214 AGTGGGAAGGAGGATGAAGTCGG - Exonic
915110455 1:153561572-153561594 CAGGAGAAAGTGGATGAGGAGGG - Exonic
915165495 1:153945957-153945979 GAGGGGGAGGAGGCTGAGGAAGG + Intronic
915269888 1:154746517-154746539 GAGGAGAAGGAGGAAGAAGATGG - Intronic
915320869 1:155055867-155055889 CAGGGGGAGGAGGATGTGCAGGG - Intronic
915351681 1:155230808-155230830 CAGGGGAAGGAGTCTGATGGGGG + Intergenic
915967419 1:160323182-160323204 AATGGGAAGGAGGGTGAAGGAGG + Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916885345 1:169061896-169061918 GAGGGGCAGGAGGAGGGAGAGGG + Intergenic
916988062 1:170213038-170213060 AAGGGAAAGGAGGAGTAAGATGG - Intergenic
917038294 1:170773573-170773595 CAGGGGAAGGGGGAGGAAGGGGG + Intergenic
917082309 1:171268669-171268691 CAGGGGAGGGAGAAAGGAGAAGG - Intronic
917618247 1:176768223-176768245 CAGGGGGAGGTGGGAGAAGAAGG - Intronic
917787760 1:178477171-178477193 AAAGGGAAGGAGAATGGAGAAGG - Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917912640 1:179666625-179666647 CATGGGAAGGAGTAAGAAAACGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918106416 1:181419199-181419221 CAGGGGGAAGAGGGAGAAGATGG - Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918434660 1:184499130-184499152 GAAGGGGAGGAGGAAGAAGAGGG - Intronic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
918601360 1:186366270-186366292 AAAGACAAGGAGGATGAAGATGG + Intronic
919071185 1:192756947-192756969 CAAAGGAAGCAGGAAGAAGATGG - Intergenic
919233281 1:194804219-194804241 TTGGGAAAGGGGGATGAAGATGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919659006 1:200225000-200225022 CAGTGGGAGGAGGATGACCAAGG - Intergenic
919860147 1:201734471-201734493 GAGGAGGAGGAGGAGGAAGAAGG + Intronic
919982877 1:202653243-202653265 CAGGGATATGAGGATGCAGATGG - Intronic
920045044 1:203127643-203127665 GAGGAGACGGAGGATGAGGAGGG + Exonic
920101898 1:203522048-203522070 CAGGGAAGGGGGGATGGAGAGGG - Intergenic
920333489 1:205228601-205228623 CAGGGCGAGGAGGATGGAGCTGG + Exonic
920346365 1:205308266-205308288 CAGGGAAGGGAAGATGATGAGGG + Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920681557 1:208077008-208077030 CAGGGAAAGGAGGATGGGGTAGG + Intronic
920864993 1:209744492-209744514 CATGGACAGGAGGCTGAAGATGG - Intergenic
921034067 1:211359644-211359666 CAGGGGAAGATAGGTGAAGAGGG - Intronic
921050658 1:211509010-211509032 AAGGGCAAGGAGGATGAGAAAGG + Intergenic
921262294 1:213395028-213395050 CAGGGGAAGGAGGGTGGGAAAGG - Intergenic
921276718 1:213528016-213528038 GAGGAGGAGGAGGAAGAAGAGGG + Intergenic
921303509 1:213772695-213772717 CCGGGGATGGAGGAGCAAGAAGG + Intergenic
921334919 1:214076332-214076354 CTGGGAAAGGAAGAGGAAGAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921520987 1:216153371-216153393 CAGGAGAGGGAGCATGCAGATGG - Intronic
921572773 1:216798462-216798484 CAAGGGAAAGAGGATGAAAAAGG + Intronic
921584031 1:216927336-216927358 CAAGGGAGGGAGCCTGAAGACGG + Intronic
921812640 1:219531964-219531986 GAGGAAAAGGAGGAAGAAGAGGG - Intergenic
921963693 1:221064804-221064826 GAGGGGAAGGAAGAGGAAGAAGG - Intergenic
922317304 1:224453875-224453897 GAGGGGAGGGAGGATAAAGAAGG - Intronic
922349765 1:224725739-224725761 CAGGGGAAGGGAGAAGATGAGGG - Intronic
922350216 1:224729068-224729090 CAGGGGAGGGTGGAGGAACAAGG + Intronic
922574886 1:226654937-226654959 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
922824942 1:228511467-228511489 GAGGGAAAGGAAGATGAGGAAGG + Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922854656 1:228764261-228764283 GAGGAGGAGGAGGAAGAAGAGGG + Intergenic
922925021 1:229341497-229341519 CAGGCGAGGGAGGATGGGGAGGG + Intronic
923052015 1:230395855-230395877 GATGGGGAGGAGCATGAAGAGGG - Intronic
923238464 1:232057659-232057681 CTGGGGAAAGAGGCTGGAGAAGG + Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923373896 1:233340591-233340613 CAGGGGAAGGGGGAGGCAGATGG + Intronic
923432462 1:233936531-233936553 GAGGAGGAGGAGGAGGAAGAAGG - Intronic
923482506 1:234397576-234397598 GATGGGGAGGAGGAGGAAGAGGG + Intronic
923534495 1:234838314-234838336 CAGGGGGAGGGGAAAGAAGAAGG + Intergenic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
923819785 1:237425737-237425759 GAGGAGGAGGAGGAAGAAGAGGG + Intronic
923827401 1:237515722-237515744 AAGGGGAAGGAGAAAGAAGGAGG - Intronic
923903464 1:238355577-238355599 GAGGAGGAGGAGGAAGAAGAGGG - Intergenic
924020270 1:239773713-239773735 CAAGGGAAATAAGATGAAGATGG + Intronic
924167185 1:241296170-241296192 GAGAGGGAGGAGGAGGAAGAAGG + Intronic
924198823 1:241639669-241639691 GAGGGGACGGAGGAAGAGGAAGG + Intronic
924258561 1:242206744-242206766 CAGGAGGAGGAGGAAGAGGATGG + Intronic
924314386 1:242780796-242780818 TAGGGGACGTCGGATGAAGAAGG - Intergenic
924481159 1:244435574-244435596 GAGGTGGAGGAGGATGAAGGAGG - Intronic
924547987 1:245048081-245048103 GAGGAGGAGGAGGAGGAAGAGGG + Intronic
924867155 1:247996087-247996109 CAGCTGAAGGAGGAAGAGGAAGG - Intronic
924872375 1:248062577-248062599 CAGGGGAGGGACGATAAAGTGGG + Intronic
1062786854 10:271934-271956 CAGGGGAGGGAGGGTGCAGGAGG - Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063131472 10:3181552-3181574 CAGGGGATGGAGGAAGGAAAAGG + Intergenic
1063343127 10:5286990-5287012 GAGGAGAAGGAGGAAGATGAAGG - Intergenic
1063386711 10:5620458-5620480 CAGGGGGAGGAGGAAGAAATGGG + Intergenic
1063623799 10:7671125-7671147 CAGAGGAAGGAGGGGGAACAAGG + Intergenic
1063624027 10:7672301-7672323 AAGGGGGAGGAAGATAAAGAAGG + Intergenic
1063771353 10:9205833-9205855 CAGTGAAATGAGTATGAAGAAGG + Intergenic
1063873992 10:10452512-10452534 GTGGGGAAGGAGGTTGAAGAGGG - Intergenic
1063916065 10:10883905-10883927 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1064273117 10:13882663-13882685 CTGGGCAGTGAGGATGAAGAGGG - Intronic
1064536340 10:16361285-16361307 GAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1064767437 10:18688939-18688961 AAGGAAAAGGAGGAAGAAGAAGG - Intergenic
1064973507 10:21089743-21089765 CAGGGGAAGGAGGGAGAAAAGGG - Intronic
1065011683 10:21426908-21426930 CGGGAGAAGGAGCATGCAGATGG + Intergenic
1065204487 10:23344169-23344191 GAGGGGAAGGGGGAAGGAGATGG + Intronic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065926093 10:30434607-30434629 TACGGGAAGGAGGAGGAAGGGGG - Intronic
1065967924 10:30784003-30784025 CAGGGGAAGGGGCTTGGAGAGGG + Intergenic
1066056430 10:31685383-31685405 CAGGGAAATGAGGATAGAGAAGG - Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066473361 10:35720811-35720833 GAGGGAAAGAAGGAAGAAGAGGG - Intergenic
1066479908 10:35785801-35785823 CAGGGGAAGGAGGCTGCAGCTGG - Intergenic
1066540398 10:36440569-36440591 GAGGGCAAAGAGGATGAAAAAGG - Intergenic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067033657 10:42897897-42897919 AGGAGGAAGGAAGATGAAGAAGG - Intergenic
1067051768 10:43025527-43025549 CAGGGGCAGGTGGAGGAGGAGGG - Intergenic
1067476267 10:46568860-46568882 AAGGTGAAGGAGGATGATGAGGG + Intergenic
1067618470 10:47772920-47772942 AAGGTGAAGGAGGATGATGAGGG - Intergenic
1067934979 10:50602490-50602512 CAGGGGAAGAAGGGAGAAGAAGG + Intronic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1068497606 10:57805277-57805299 GATGTGAAGCAGGATGAAGAAGG - Intergenic
1068568964 10:58607485-58607507 GAGGAGAAGGAGGATAAAGGAGG - Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070171695 10:73937855-73937877 CTGGGGAAGGAGGAGGATGTTGG + Intergenic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1071517878 10:86311015-86311037 CATGGGCAGGAGGAAGAGGAGGG + Intronic
1071829611 10:89358780-89358802 GAGGGGAGGGAAGATAAAGAGGG + Intronic
1071835927 10:89416647-89416669 CAGCCCAAGGAGGATGAGGAGGG - Intronic
1071877808 10:89861482-89861504 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
1072019378 10:91383130-91383152 GAGTAGAAGGAGGATGAAGCAGG - Intergenic
1072069136 10:91899738-91899760 CAGGGCAAGTAGGAGGAAGGAGG - Intergenic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1072925272 10:99611530-99611552 GAGGGGAAGGAGTAAGCAGAGGG + Intronic
1073146703 10:101285976-101285998 CAAGGGAAAGAGGAGGCAGAGGG - Intergenic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073340906 10:102743962-102743984 GAAGGGAAGAAGGAAGAAGAGGG + Exonic
1073371645 10:102995153-102995175 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073371652 10:102995171-102995193 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073427738 10:103466117-103466139 CAGGGAAGGGAGGTTGAAGAAGG - Intergenic
1073434231 10:103506523-103506545 GAGGAGGAGGAGGAGGAAGAAGG - Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1074138677 10:110651187-110651209 CAGGTGATGGAGGAAGTAGATGG - Intronic
1074220844 10:111436385-111436407 GAGGGGAAGGAGCACCAAGATGG - Intergenic
1074330537 10:112503249-112503271 GGGGGAGAGGAGGATGAAGAGGG - Intronic
1074384663 10:113007311-113007333 CAGGGGATGGAGGCTAGAGAAGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074559592 10:114523303-114523325 CAGGGCAAGGGGGGTGCAGATGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074729691 10:116356357-116356379 GGGGGGGAGGAGGAAGAAGAGGG + Intronic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1074960994 10:118445813-118445835 TAGGGGAGGGTGGATGGAGAAGG - Intergenic
1075328350 10:121553252-121553274 AAGAGGAAGGAGGAGAAAGAAGG + Intronic
1075355979 10:121776300-121776322 GTGGGGAGGGAAGATGAAGAGGG - Intronic
1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG + Intronic
1075451239 10:122553149-122553171 CAGGGGTGGGAGGGAGAAGAGGG + Intergenic
1075564172 10:123491729-123491751 CAGGAGAAGTAGGATGTAAAAGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075802082 10:125160191-125160213 GAGGAGGAGGAGGAGGAAGAGGG - Intronic
1075802342 10:125160925-125160947 CCGGGGAAGGAGAAGGAAAACGG + Intronic
1076069995 10:127481810-127481832 GAAGGGAAGGAGGATGTAGTGGG - Intergenic
1076122195 10:127945109-127945131 CAGGGGAAGGGTGAGGAAGCTGG - Intronic
1076403845 10:130199970-130199992 CGGGGGAAGGACGGTGAAGGTGG + Intergenic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077392506 11:2306726-2306748 GAGGAGGAGGAGGACGAAGAAGG + Intronic
1077392581 11:2306941-2306963 GAGGAGAAGGAGGAGGGAGAAGG + Intronic
1077607595 11:3622615-3622637 CAGGGGAAGGAGGGAGAGTAGGG - Intergenic
1077913675 11:6596639-6596661 CCTGGGAAGGAGGATGACCAGGG + Exonic
1078082041 11:8211232-8211254 CAGAGAAAGGTGGATGGAGATGG + Intergenic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078168227 11:8909423-8909445 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1078729090 11:13959701-13959723 GAGGAGAGGGAGGAGGAAGAAGG + Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079182155 11:18203507-18203529 AAGTGGAAGGAGGAAGAAGAAGG + Intronic
1079202900 11:18390638-18390660 GTGGGGATGAAGGATGAAGAGGG - Intergenic
1079234060 11:18674900-18674922 CTGGGGAAGAAGGTTGCAGATGG - Intergenic
1079336059 11:19571912-19571934 CAGAGATGGGAGGATGAAGAAGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079449560 11:20588044-20588066 AAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079810962 11:24999418-24999440 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080099557 11:28443819-28443841 CAGGGGAACAATGATGAAGGTGG - Intergenic
1080147442 11:29004312-29004334 AAGGAGAAGGAGGAAGAAAAAGG - Intergenic
1080252050 11:30244474-30244496 CAAGGGAGGGAGGATTAAGTGGG - Intergenic
1080456906 11:32427017-32427039 GAGGGGAGGGAGGATGGGGATGG + Intronic
1080484066 11:32686118-32686140 CAGATGAAAGAGGATGATGAAGG + Intronic
1080603218 11:33841331-33841353 AAGGGAAAGGAGGAGGGAGAAGG - Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1081555590 11:44157758-44157780 CAGGGGAAGGAGAGAGAAAAGGG - Intronic
1081594744 11:44451290-44451312 CAGGAGATGGAGGATGCAGTGGG + Intergenic
1082069908 11:47930960-47930982 CAGAAAAAGGAGGATGCAGAAGG - Intergenic
1082198705 11:49335914-49335936 GAGGGGAAGGAGGCAGAGGAGGG + Intergenic
1082738278 11:56881744-56881766 CAGGAGGAAAAGGATGAAGAGGG - Intergenic
1082789684 11:57338719-57338741 CCGAGGCAGGAGGGTGAAGACGG - Intronic
1082889425 11:58122733-58122755 CAGGGGAAGGAGTAAGAATGAGG - Intronic
1082892424 11:58154177-58154199 GAGGGGAAGGAGGAGGAGAAGGG + Intronic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083337386 11:61931655-61931677 GAAGGCAAGGAGGAGGAAGAAGG + Intergenic
1083429965 11:62609169-62609191 CAAGGGCAGGAGGAGGAAGAGGG + Intronic
1083593806 11:63909749-63909771 GAGGGGAAGGAGGGAGGAGAGGG - Exonic
1083725024 11:64623416-64623438 CTGAGGGAAGAGGATGAAGAGGG - Intronic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083951383 11:65958506-65958528 CAAGGGAAAGAGGATGGGGAGGG + Intronic
1084122371 11:67077280-67077302 CAGGGTGAGGAGGATGGAGGAGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084596154 11:70118190-70118212 GAGGGGGAGGAGGGGGAAGAGGG - Intronic
1084742715 11:71149938-71149960 GAGGGGAAGGAGGGAGAGGAGGG + Intronic
1084758991 11:71256424-71256446 CAGCGGAAGGGAGATGCAGAAGG - Intergenic
1084883517 11:72188902-72188924 CCGGGGAAGGTGGTTGTAGAGGG - Intergenic
1084937020 11:72592317-72592339 CTGGGGAGGGAGGAGGAAGGAGG - Intronic
1085112242 11:73898206-73898228 GAGGGGAAGGGGGAGGGAGAGGG + Intronic
1085397377 11:76213453-76213475 CAAGGGAAGGAAGCTGAAGTGGG - Intergenic
1085433064 11:76473233-76473255 AAGAGGTAGGAGGAAGAAGATGG + Intronic
1085596100 11:77811583-77811605 CAAGGGAAGGAAGATGGGGATGG + Intronic
1085684580 11:78610119-78610141 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1085760416 11:79236679-79236701 CACTGGAAGGAGGTTGAAGTGGG - Intronic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1086066879 11:82754958-82754980 CAGTGGAAAGAGTGTGAAGATGG - Intergenic
1086221797 11:84454228-84454250 CAAAGGAAGGAGGAAGAAGAAGG + Intronic
1086286448 11:85256638-85256660 CAGGAGGAGGAGCATGCAGATGG - Intronic
1086577771 11:88360507-88360529 TAGGGGCAGGTGGATGAATAGGG - Intergenic
1086931886 11:92702571-92702593 CAAGGGGAGGAGGAAGTAGATGG - Intronic
1087498734 11:98923655-98923677 GAGGGAAAGGAAGAGGAAGAAGG - Intergenic
1087535018 11:99431916-99431938 CAGGGGCTGGAGGGTCAAGAGGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087605652 11:100374399-100374421 CAGATGAAAGAGGATGAAGAGGG - Intergenic
1087847473 11:102989770-102989792 GAGGGGGAGGAGGAAGAAGTGGG - Intergenic
1088894280 11:114066128-114066150 CAGGGGAATGGGGGTGAAGGGGG - Intronic
1089025273 11:115262882-115262904 TAGGAGAAGGTGGATGAAGAAGG - Intronic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089215013 11:116829967-116829989 GGAGGGGAGGAGGATGAAGAGGG + Intronic
1089288002 11:117420017-117420039 CTGGGGAAGGAGGCTGAGGTGGG + Intergenic
1089323093 11:117639648-117639670 GGAGGGAAGGAGGATGCAGACGG + Intronic
1089324442 11:117647656-117647678 AAAGGGAAGGGGGATGAGGAGGG + Intronic
1089527446 11:119106806-119106828 AAGAGGAAGGAGGGTGATGATGG + Intronic
1089528709 11:119113090-119113112 GAGGGGCAGGAGGATCCAGAAGG - Intronic
1089596052 11:119581003-119581025 GAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090365714 11:126203586-126203608 CAGGTGAAGGGGGATGTAGCGGG + Exonic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464632 11:126923319-126923341 AAGGAGAAGGAAGAAGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090697547 11:129263587-129263609 GAGGAGAAGGAGGAGGAAAATGG + Intronic
1090738841 11:129638027-129638049 GAGGAGATGGAGGTTGAAGAGGG - Intergenic
1090792058 11:130098992-130099014 CAGGGGTGGGGGGATGTAGAAGG - Intronic
1091074175 11:132599332-132599354 GAGGAGGAGGAGGAGGAAGAAGG + Intronic
1091174319 11:133545951-133545973 CAGGGGGAGGAGGCTGCACAGGG - Intergenic
1091174325 11:133545969-133545991 CAGGGGGAGGAGGCTGCACAGGG - Intergenic
1091174340 11:133546022-133546044 CAGGGGAAGGAGGCTGCACAGGG - Intergenic
1091174345 11:133546040-133546062 CAGGGGGAGGAGGCTGCACAGGG - Intergenic
1091174370 11:133546128-133546150 CAGGGGAAGGAGGCTGCACACGG - Intergenic
1091174374 11:133546146-133546168 CAGGGGGAGGAGGCTGCACAGGG - Intergenic
1091174380 11:133546164-133546186 CAGGGGGAGGAGGCTGCACAGGG - Intergenic
1091174405 11:133546252-133546274 CAGGGGGAGGAGGCTGCACAGGG - Intergenic
1091174443 11:133546375-133546397 CAGGGGGAGGAGGCTGCACAGGG - Intergenic
1091239063 11:134040335-134040357 GAGGTGAAGGTGGGTGAAGACGG + Intergenic
1091336607 11:134773577-134773599 GAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091603082 12:1929782-1929804 TAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1091603089 12:1929800-1929822 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1091603108 12:1929859-1929881 GAGGAGGAGGAGGAGGAAGAGGG + Intergenic
1091603128 12:1929918-1929940 GAGGGGGAGGAGGAGGAAGAGGG + Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1091886096 12:4018185-4018207 CAGGGGCAGAAGTCTGAAGAGGG - Intergenic
1092015596 12:5155996-5156018 GAGGGGAAGGAGGAAGACCAGGG - Intergenic
1092294713 12:7189198-7189220 CAGGCCTAGGAGGCTGAAGAAGG + Intronic
1092329597 12:7571515-7571537 CTGGGGAAGGAAGAAGAACATGG - Intergenic
1092509817 12:9143420-9143442 CAGGGGGATGAGGATAGAGAGGG + Intergenic
1092749922 12:11709228-11709250 CAGGGGTAGAATGAGGAAGAAGG - Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093508399 12:19896765-19896787 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1094095600 12:26700721-26700743 AAGGGGACAGAGGATGAAAAAGG + Intronic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095728372 12:45476809-45476831 CAGTCAAAGGAGGAAGAAGAGGG - Intergenic
1095752778 12:45729627-45729649 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1095800404 12:46266454-46266476 CAGCGGAAGGAACAGGAAGAAGG - Intronic
1096146195 12:49280714-49280736 GAGGAGGAGGAGGAAGAAGAGGG - Intergenic
1096183939 12:49566278-49566300 CAGGGGAAGGGGGCTGGGGAGGG - Intronic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096257414 12:50071981-50072003 CAGTGGCAGAAGGATGGAGAGGG + Intronic
1096300827 12:50425899-50425921 CAGGGGAAGAAGGAGGAAATGGG - Intronic
1096330449 12:50707809-50707831 CATGGGAGGGAGGATGAAGTTGG - Intronic
1096692996 12:53332738-53332760 AAGGGGGAGGAGGAGGAAGAAGG + Intronic
1096779771 12:53985148-53985170 GAGGGGAGGGAGGAAAAAGAAGG - Intronic
1096784914 12:54011307-54011329 GAGGAGAAGGTGGAGGAAGAAGG + Exonic
1096833240 12:54330882-54330904 CAGGGGACAGCTGATGAAGATGG + Intronic
1096909780 12:54971274-54971296 CAGAGGAAAGAGGATAAACAAGG - Intronic
1097085783 12:56467254-56467276 GAGGGGTAGGAGGATGGAGGTGG + Intronic
1097151602 12:56983451-56983473 CAGGTGCAGGAGGATGAGGGAGG + Intergenic
1097174778 12:57136229-57136251 CAGGGGAGGGAGGCTGAAGGGGG + Intronic
1097282660 12:57854250-57854272 AAGGGGAGGAAGGAGGAAGAAGG + Intergenic
1097658783 12:62403651-62403673 AAGGGGAAGTAGAATGGAGAGGG + Intronic
1097888637 12:64755502-64755524 CAGGAGAAGGAGGTTGCAGTGGG + Intronic
1097905537 12:64915395-64915417 CAGGTGAAGGAGGAGGGAAAGGG + Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098305663 12:69100133-69100155 AAGAGGAAGGAGTATTAAGAAGG + Intergenic
1098495862 12:71135210-71135232 GAGGAGGAGGAGGAAGAAGAAGG + Intronic
1098652666 12:72992715-72992737 CATGTGAAGGAGTGTGAAGATGG - Intergenic
1098655843 12:73028284-73028306 CAGGAGGAAGAGGGTGAAGAGGG - Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099337462 12:81381525-81381547 CAGGGCCAAGAGAATGAAGATGG + Intronic
1099635996 12:85212209-85212231 CAGGAGATGGAGGCTGCAGATGG + Intronic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100190477 12:92185823-92185845 GAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1100215607 12:92445027-92445049 CACGGGAAGGAGCCAGAAGATGG - Intergenic
1100449930 12:94696076-94696098 AGGGGGAAGGAGGGAGAAGAGGG + Intergenic
1100464366 12:94832344-94832366 CAGGGGAATGAGAGTAAAGAAGG + Intergenic
1100524629 12:95407870-95407892 GGCGGGAAGGAGGATGAAGGGGG - Intergenic
1100550689 12:95644204-95644226 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1100679107 12:96899478-96899500 CAGGTGGAGGAGGGTGCAGAGGG - Intergenic
1101289333 12:103351917-103351939 GAGGGGAAGGGGGATAGAGAGGG - Intronic
1101413189 12:104486056-104486078 GAGGGGAAGGAAGACGAAGATGG - Intronic
1101676433 12:106921220-106921242 CACTGGAAAGAGAATGAAGAGGG - Intergenic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1101964804 12:109275103-109275125 CAGGGAAAGGAATAAGAAGATGG - Intergenic
1102230367 12:111257636-111257658 AGGAGGAAGGAGGAGGAAGAGGG - Intronic
1102383163 12:112484493-112484515 CAGGGGCAGGAGGAGGCAGGTGG + Intronic
1102394197 12:112574036-112574058 AAAGGGGAGGAGGAGGAAGAGGG + Intronic
1102397052 12:112595495-112595517 AAGGGGAAGGAGGAGGGAGAGGG - Intronic
1102618019 12:114171750-114171772 CTGGGGTAGGAAGAGGAAGAGGG + Intergenic
1102663506 12:114549775-114549797 GAGGGTGAGAAGGATGAAGATGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102679847 12:114684015-114684037 CAGGGCAGGGAGGATTTAGAGGG + Intronic
1102865218 12:116368887-116368909 GAGGGGAAGCAGAATGTAGACGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103177336 12:118876066-118876088 CAGAGGAGGGAGTATGAAAATGG - Intergenic
1103348086 12:120264758-120264780 CAGGGGAATGAGGTGGAAGGTGG - Intronic
1103477938 12:121232389-121232411 GAGGGGAAGGAGGATGGATCAGG - Intronic
1103778872 12:123386287-123386309 CAGGAGAGGGAGGGTGAAGCGGG - Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104602775 12:130164126-130164148 CAGGGGAATGAGCACGAAGCCGG - Exonic
1104606566 12:130193737-130193759 CAGGGTAGAAAGGATGAAGACGG - Intergenic
1104616365 12:130273330-130273352 TAAGGGGAGGAGGAGGAAGAGGG - Intergenic
1104616388 12:130273443-130273465 GAGGAGAAGGAAGAAGAAGAAGG - Intergenic
1104849211 12:131863277-131863299 AAGGGGAGGGAGGGTGAAGTGGG + Intergenic
1105486259 13:20835840-20835862 CAGGAGGAGGAGGAAGAGGAGGG - Intronic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1105974531 13:25461864-25461886 GAGGAGGAGGAGGAGGAAGAAGG + Intronic
1106175984 13:27332090-27332112 CACAGGAATGAGGAGGAAGAGGG + Intergenic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106574155 13:30958601-30958623 AAAGGGATGTAGGATGAAGATGG - Intronic
1106753575 13:32798690-32798712 CGGGGGAAGGAAGGGGAAGAAGG - Intergenic
1106835554 13:33630792-33630814 AAGGTGAAGGAGGATTAGGATGG - Intergenic
1106856597 13:33860309-33860331 CAAGGGAAGGAGGAGGATGGAGG + Intronic
1106917745 13:34533168-34533190 AAAAGGAAGGATGATGAAGACGG - Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107149101 13:37091287-37091309 CATGGGAAAAAGGAAGAAGAGGG + Intergenic
1107216840 13:37931623-37931645 GAGGAGAAGGAGGAAGAATATGG - Intergenic
1107436567 13:40385557-40385579 GAGGAGAAGGAGGAAAAAGAGGG + Intergenic
1107469055 13:40675023-40675045 CTGGGGAAGTAGGGTGGAGAAGG + Intergenic
1107928158 13:45283802-45283824 TAGGGGTTGGAGGATTAAGAGGG + Exonic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108132512 13:47318022-47318044 GAGGGGGAGGAGGAAGAAGGAGG - Intergenic
1108167420 13:47708157-47708179 CAGGGTAAGGAGGATCTGGAAGG - Intergenic
1108613820 13:52110982-52111004 CAGTGGAAGGAGGGTGACAAGGG + Intronic
1108867341 13:54939297-54939319 CAGGGGATGGTGCATGGAGAGGG + Intergenic
1108935321 13:55874817-55874839 CAGAGGAAGGGGGATGACAAAGG + Intergenic
1109048287 13:57441408-57441430 GAGGAGGAGGAGGAAGAAGAGGG + Intergenic
1109704594 13:66073379-66073401 CAGGGAAAAGAGGATGGAGATGG + Intergenic
1109762249 13:66845254-66845276 CATGGGAGGGAGGCTGAAGTGGG - Intronic
1110390995 13:74973839-74973861 CAGGGAAGGGAGGAAGAGGAAGG + Intergenic
1110515882 13:76411536-76411558 GAGGAGAAGGGGGAGGAAGAGGG + Intergenic
1111253626 13:85638867-85638889 CATGGGAGGGAGGCTGAAGGGGG - Intergenic
1111743014 13:92228084-92228106 GAGGAGGAGGAGGAAGAAGATGG + Intronic
1111794701 13:92903824-92903846 CAAGTGAAGGAGGATGAAGGTGG + Intergenic
1111854531 13:93621117-93621139 CAGGGGAAAGAGGGTGAGGTTGG + Intronic
1111929329 13:94497692-94497714 GAGGAGGAGGAGGAAGAAGAGGG + Intergenic
1111979852 13:95004095-95004117 CGGGGGAAGGAGGGGGGAGAAGG + Intergenic
1112069844 13:95837429-95837451 CCTGGGAACAAGGATGAAGAAGG + Intronic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112311079 13:98318019-98318041 AAGAGGGAGGAGGAGGAAGAAGG - Intronic
1112404350 13:99105102-99105124 AAGAAGAAGGAAGATGAAGAGGG - Intergenic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112765481 13:102737519-102737541 CAAGGGAAAGAGGACGGAGAAGG - Exonic
1112774102 13:102825573-102825595 CAGGGGAGGTAGGCTGAAGCAGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113180358 13:107618350-107618372 CAAAGGGAGGAGGTTGAAGAGGG + Intronic
1113308273 13:109102208-109102230 AAAGGGAAGGAGGAAGAAGGAGG + Intronic
1113326528 13:109287444-109287466 CAAGGAAAGGAGGATGAGAAAGG + Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113613316 13:111663414-111663436 GAGGAGGAGGAGGAGGAAGAAGG - Intronic
1113659520 13:112096123-112096145 AAGGGGAGGGAGGAGGAAGGGGG - Intergenic
1113876170 13:113596225-113596247 GCAGGGAAGCAGGATGAAGAGGG + Intronic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1113933448 13:113980850-113980872 GAAGGGAAGGAGGGAGAAGAAGG + Intronic
1114038139 14:18648884-18648906 GAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114120474 14:19666155-19666177 GAGGAGGAGGAGGAGGAAGAGGG + Intergenic
1114173752 14:20300410-20300432 CTGGGAAAGGAAGATGATGATGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114298646 14:21353813-21353835 CAGGGGAGTGATGCTGAAGAAGG - Exonic
1114373152 14:22112392-22112414 TAGGAGAAGTTGGATGAAGAGGG + Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114521086 14:23336736-23336758 AAGGGGAAGGAGGAATAGGATGG - Intergenic
1114539844 14:23446723-23446745 CAGGGCCAGGAAGACGAAGAGGG - Intergenic
1114748874 14:25181496-25181518 CATGGGTAGAAGGATGAAAATGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115761717 14:36582848-36582870 CAGGAGGAGGAGGAGGAAGCTGG - Intergenic
1116329101 14:43573843-43573865 CTGTGGAAGGAGGATGAATTGGG + Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116747869 14:48844958-48844980 CAGCAGAAGGTGGAAGAAGATGG + Intergenic
1116859303 14:49980911-49980933 GAAGAGAAGGAGGATGACGAAGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117339128 14:54778881-54778903 AAGGGGAAGGAGGCTGCAGAAGG + Intronic
1117355321 14:54918551-54918573 CAGGGGAAGAGGGATTTAGAGGG + Intergenic
1117661399 14:58009333-58009355 CAGAGGAAGGAGGAAAAAGGGGG - Intronic
1117916916 14:60687448-60687470 CAGGGCAAGAAGGAGAAAGAAGG + Intergenic
1117922132 14:60735711-60735733 CAGGGGAAGGGGGCAGAAGGAGG + Intronic
1118073455 14:62271412-62271434 GAGGGGTAGGAGAATGAAGGTGG - Intergenic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118577785 14:67260874-67260896 CAGGGGAGGGAGAAAGAAAATGG + Intronic
1118796634 14:69151587-69151609 CAGGGGAGGGGGGGTGAAGACGG - Intronic
1119067384 14:71542580-71542602 GAGGAGGAGGAGGAAGAAGAAGG - Intronic
1119074341 14:71621037-71621059 CAGGGGCAGGAGGGAGAAGATGG - Intronic
1119180390 14:72601062-72601084 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1119327844 14:73772130-73772152 CAGGGGCTGGAGGATTCAGATGG - Intronic
1119478820 14:74947234-74947256 CAGGGCAAAGGGGATGGAGAAGG + Intronic
1119494286 14:75065108-75065130 AAGGGGGATGTGGATGAAGATGG + Intronic
1119557043 14:75561202-75561224 CTGGGAAAGGAGGATGCAGGAGG - Intergenic
1119684946 14:76624090-76624112 CAGGCGTTGGAGGAAGAAGAGGG - Intergenic
1119745083 14:77038303-77038325 TAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1119822495 14:77629847-77629869 GGAGGGAAGGAGGATGAAAAAGG + Intergenic
1119850161 14:77861293-77861315 AAGGGGGAGGAGGAGGAAGAGGG - Intronic
1119888215 14:78162260-78162282 CTGGAGAAGGAGGGTGCAGATGG + Intergenic
1120484852 14:85100230-85100252 GAGGCTAAGGAGGAGGAAGAGGG + Intergenic
1120527581 14:85595044-85595066 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1121056816 14:90862424-90862446 GAGGAGGAGGAGGAAGAAGAAGG - Exonic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1121437678 14:93929746-93929768 CAAAGGAAGGAGGGTGAGGAGGG + Intergenic
1121468175 14:94129307-94129329 CAGGGGAAGGCAGAGGGAGATGG + Intronic
1121515715 14:94548552-94548574 CAGGGTTTGGAGGATGAAGCAGG + Intergenic
1121593267 14:95137174-95137196 AAGGGGAAGGAGAAGGAAAAGGG + Intronic
1121644007 14:95505267-95505289 CTGGGGAAGGTGGAGCAAGAGGG + Intergenic
1121667843 14:95686295-95686317 GAGGGGGAGGAGGAGGAAGGGGG - Intergenic
1121684311 14:95821737-95821759 CAGGAGAAAGAGAATGCAGAGGG - Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1122016782 14:98803273-98803295 GAGGAGAAGGAGGAGGAAGGGGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122091136 14:99341322-99341344 CTGGGGAAGGACGAGGAAGAAGG + Intergenic
1122164044 14:99807721-99807743 CAGGGGAGAGAGGGTGGAGACGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122283274 14:100636741-100636763 CAGGGGAAGGAGCAGGGAGTGGG - Intergenic
1122322288 14:100862272-100862294 CAGGAGGAGGAGGAGAAAGAAGG - Intergenic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1122687178 14:103514900-103514922 GAGGGGAAGAGGGATGCAGAAGG + Intergenic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123124994 14:105940169-105940191 CACGGGCAGGAAGATGAGGAAGG + Intergenic
1123151495 14:106185965-106185987 CAGGTGAAGGAGGCTGGGGAGGG - Intergenic
1123626708 15:22232160-22232182 GAGGGGAAGGCGCATGAAGATGG + Intergenic
1123991595 15:25687572-25687594 CAGGCGAAGGAGGATGGAGCAGG + Intronic
1124546897 15:30637260-30637282 CAGGATAAAGAGGATAAAGATGG - Intronic
1124548152 15:30651929-30651951 GAGGGGAAGGAAGGGGAAGAAGG - Intronic
1124780499 15:32627256-32627278 CAGGATAAAGAGGATAAAGATGG - Intronic
1124795387 15:32773267-32773289 CATGTGAAGTAGGATGAAGCAGG - Exonic
1124801451 15:32837039-32837061 CAGAGTGAGAAGGATGAAGATGG - Intronic
1124820806 15:33044166-33044188 CATGGGATGGAGGCTGAGGAGGG + Intronic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125045266 15:35237929-35237951 GAGGAGGAGGAGGATGAAAAAGG + Intronic
1125432982 15:39615784-39615806 CAGTGGCTGGGGGATGAAGAGGG + Intronic
1125496278 15:40197457-40197479 AAGGTGAAGGAGAATAAAGAAGG + Intronic
1125705250 15:41729266-41729288 GATGGGGAGGAGGAGGAAGATGG - Exonic
1125727893 15:41877398-41877420 GAGGAGAAGGAGGCTGACGAGGG - Intronic
1125731320 15:41894158-41894180 CGGGGAAGGGAGGATGATGAAGG - Intergenic
1125772604 15:42180011-42180033 CATGTGAAGGAGCATCAAGAAGG + Intronic
1125790481 15:42361759-42361781 CTGGGGAAAGAGGATGGACATGG - Intronic
1125926669 15:43568681-43568703 TAGGGGAAGAGGGATGAAAAGGG + Intronic
1125939813 15:43668246-43668268 TAGGGGAAGAGGGATGAAAAGGG + Intergenic
1125983923 15:44030710-44030732 AAGGTGAAGGAGGAGGAAGATGG + Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126195426 15:45925522-45925544 CTGGGGAGGGAGGATGATGTAGG - Intergenic
1126674878 15:51152440-51152462 AAGAGGAAGAAGGAAGAAGAAGG + Intergenic
1126896062 15:53258328-53258350 CACGTGCAGGAGGATGAAGTTGG + Intergenic
1127122051 15:55780297-55780319 AAGAGGAAGGAGGAAGCAGAAGG + Intergenic
1127674851 15:61229035-61229057 CAGAGGTAGGAGGCTGGAGAGGG - Intronic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1127998864 15:64172248-64172270 TACTGGAAGGAGGGTGAAGAAGG + Intronic
1128068982 15:64782113-64782135 CAGGAGAAGGAGGTTGCAGTGGG - Intergenic
1128095809 15:64954493-64954515 GAGGAGAAGAAGGAAGAAGAAGG - Intronic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128142710 15:65313459-65313481 CAGGGAAAAGAACATGAAGATGG - Intergenic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1128389791 15:67175113-67175135 GAGGGGAAGGAGGAGGCAGGTGG + Intronic
1128560208 15:68659959-68659981 GAAGGGGAGGAGGAAGAAGAGGG + Intronic
1128705026 15:69832307-69832329 AAGGGGAAGGGGGAAAAAGAAGG + Intergenic
1128706846 15:69842886-69842908 GAGGGGAAGGAAGAGGCAGACGG - Intergenic
1128758882 15:70201476-70201498 GATGGGAAGGAGGATGGAGTTGG - Intergenic
1129108329 15:73323517-73323539 ATGTGGAAGGAGGATGAAGACGG + Exonic
1129658824 15:77541903-77541925 GAAGGGAAGGAGGAGGAAGGAGG - Intergenic
1129983997 15:79900322-79900344 GAAGGGAAAGAGGAAGAAGAGGG - Intronic
1130068789 15:80629053-80629075 CAGGAGGAGGAGAATGAAGGGGG + Intergenic
1130128718 15:81117874-81117896 AAAGAGGAGGAGGATGAAGAAGG - Intronic
1130226113 15:82059217-82059239 GAGGGGGAGGAGGAGGGAGAGGG - Intergenic
1130258172 15:82335407-82335429 CAGGGGCGGGAGGCTGGAGAAGG + Intergenic
1130596757 15:85254553-85254575 CAGGGGCGGGAGGCTGGAGAAGG - Intergenic
1130989979 15:88870358-88870380 CAGGGGAAGAAGGAAGAAGGGGG + Intronic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131031267 15:89187916-89187938 CAGGGGAGGGGGGCTCAAGACGG - Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1132078647 15:98845528-98845550 GAGGGGGAGGAGGAGGAAGGAGG - Intronic
1132222727 15:100117009-100117031 CAGGGCTAGAAGGAAGAAGAAGG + Exonic
1132225218 15:100135096-100135118 CAGGAGAAAGAGGAAGAAGGTGG + Intronic
1132284369 15:100650439-100650461 CAGGGATAGGAGGAGGCAGAGGG + Exonic
1132922006 16:2400780-2400802 GAGGGGGAGGAGGAGGGAGAGGG + Intergenic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1133103747 16:3494134-3494156 CAGGGGAGGGAGGAGGTTGAGGG + Intronic
1133189800 16:4125221-4125243 CAGGGGCAGGAGGTGGAAGCTGG + Intergenic
1133225444 16:4338384-4338406 CGGGGGTAGAAGGAGGAAGACGG - Exonic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133392645 16:5422410-5422432 GAGAGGAAGGAGGAGGGAGAGGG + Intergenic
1133392853 16:5423089-5423111 AAGAGGAAGGAGGAGGGAGAGGG + Intergenic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133517595 16:6524800-6524822 CAGGTGATGGAGGAAGAAGGTGG - Intronic
1133536570 16:6708036-6708058 CAGGGGAAAGACGATGGAAAAGG - Intronic
1133580716 16:7141991-7142013 AAGAAGAAGGAGGAAGAAGAAGG - Intronic
1133589596 16:7229725-7229747 CAAGGGAGGGAGGGGGAAGAAGG + Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133748698 16:8707521-8707543 TAGGGAAAGGAGGAAGAAAAGGG - Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134329615 16:13238525-13238547 GAGGAGAAGGAGCATGCAGAAGG - Exonic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1134398029 16:13883338-13883360 CCGCGGAAGGAGGATGATTAAGG - Intergenic
1134449268 16:14353882-14353904 CAGGGGGAGGAAGAAGAGGAGGG + Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134634259 16:15780061-15780083 CTTGGGAAGGAGAGTGAAGAAGG - Intronic
1134718992 16:16370696-16370718 GAGGGGAAGGAGGATAAGGGAGG - Intergenic
1134750338 16:16619888-16619910 CAGGGGGAGGGGGAGGGAGAGGG + Intergenic
1135178887 16:20255763-20255785 GTGGGCAAGGAGGAGGAAGAAGG - Intergenic
1135495732 16:22949643-22949665 GAGGGGAAGGAGGGGAAAGAGGG + Intergenic
1135697386 16:24602010-24602032 CAGAGGAAGAAAGATAAAGATGG - Intergenic
1135700569 16:24628526-24628548 AATGGGGAGGAGGAAGAAGAGGG - Intergenic
1135983745 16:27168562-27168584 TAGGGGAAGAAAGATGAAGGAGG + Intergenic
1135983747 16:27168572-27168594 AAGATGAAGGAGGATGGAGAAGG + Intergenic
1136045913 16:27614819-27614841 CAGGGGAAGATGGAAGCAGATGG + Intronic
1136173501 16:28502473-28502495 AATGGGAATGAGGCTGAAGATGG - Intronic
1136403532 16:30030840-30030862 CAGGAGGAGGAGGATGCGGATGG + Exonic
1136464754 16:30434851-30434873 CAGGTGATGGTGGGTGAAGATGG + Intergenic
1136532090 16:30876575-30876597 CAGGGGAAGTGAGATGAAGGAGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136544354 16:30947449-30947471 CAGGGGATGGACAATGAAGCAGG - Exonic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137253442 16:46756975-46756997 GAGGGGCAGGAGGAGGAAGGGGG + Intronic
1137706498 16:50539294-50539316 CAGGGGGAGGAGGAGAAAGTGGG - Intergenic
1138229127 16:55324825-55324847 CAGGGGAAGGAAGAAGATGCGGG - Exonic
1138350609 16:56344488-56344510 CAGGGGAGGGAGCAGGGAGACGG - Exonic
1138495513 16:57406633-57406655 CAGTGGGAGGAGCATCAAGAAGG + Intronic
1138541608 16:57691080-57691102 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1138541623 16:57691135-57691157 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1138887650 16:61098894-61098916 GAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139060950 16:63250708-63250730 AAGGGGAAGGAGGAGGGAAAGGG + Intergenic
1139589062 16:67923170-67923192 CATGGGTAGGGGGATGAGGAAGG + Intronic
1139846320 16:69924296-69924318 CATGGGCAGGAGGATGAATGGGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1139946331 16:70644912-70644934 GAGGAGAAGGAGGAGGAAGGAGG + Intronic
1140029205 16:71321125-71321147 CATGGGAAGGAGGGAGAAGAAGG + Intergenic
1140104434 16:71946811-71946833 GAGGGGGAGGAGGAGGGAGAAGG + Intronic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1140790051 16:78383000-78383022 CAGGAGCAGGAGGACGAATAGGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141495414 16:84406423-84406445 CAGGGGCCAGAGAATGAAGAAGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141710073 16:85693503-85693525 CAGGGGAAGGAAGGGGAAGTGGG - Intronic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141845127 16:86603409-86603431 CAGTAGGAGGAAGATGAAGAAGG - Intergenic
1141845138 16:86603466-86603488 CAGTAGGAGGAAGATGAAGAAGG - Intergenic
1141845171 16:86603637-86603659 CAGTAGGAGGAAGATGAAGAAGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1141891769 16:86930911-86930933 GAGGGGGAGGAGGGGGAAGAAGG - Intergenic
1141977278 16:87525256-87525278 GAGGGGAAGGTGCATGAAGATGG - Intergenic
1142137826 16:88459731-88459753 GAAGGGGAGGAGGAGGAAGAGGG - Intronic
1142387348 16:89774315-89774337 CAGGGGAAGGAGGATCCTGGGGG + Intronic
1142856315 17:2732293-2732315 AAGGGGAAGGAGATTAAAGAGGG - Intergenic
1143035131 17:3990770-3990792 AAGGAGTAGGAGGAAGAAGAAGG - Intergenic
1143254423 17:5544965-5544987 AGGGGGAAGGAGGCTGAAGGTGG + Intronic
1143287323 17:5800057-5800079 GAGGAGAAGGAGGAAGGAGAGGG - Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143391335 17:6560973-6560995 GAAGAGAAGGAGGAAGAAGAGGG - Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143403446 17:6660472-6660494 CAGGCTAAGGAGCATGAAGTGGG + Intergenic
1143410415 17:6705080-6705102 CAGGGGTAGGAGCCTGAAGAAGG + Intronic
1143410857 17:6707538-6707560 GAGAGGAAGGGGGATGGAGAAGG + Intronic
1143497545 17:7321131-7321153 GAGGGCGAGGAGGATGACGAGGG - Exonic
1143514469 17:7412966-7412988 AAAGGGAAGGAGCAGGAAGAGGG - Intronic
1143709972 17:8727393-8727415 CAGGGGCAGGAGACTGAAGGAGG - Intergenic
1143724339 17:8835181-8835203 CAGGAGAAGGAGGAAGAGCAGGG + Intronic
1143762040 17:9111851-9111873 GAGGGGGAGGAGGAAGAAGAGGG + Intronic
1143880292 17:10024667-10024689 CAGGTGAGGGTGGATGGAGAGGG - Intronic
1144144897 17:12387974-12387996 GACTGGAAGGAGGATGATGAGGG + Intergenic
1144334351 17:14255636-14255658 CAGGGGAAGAGGAATCAAGATGG - Intergenic
1144646145 17:16974904-16974926 AAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1144656618 17:17041460-17041482 TAGGGGAAGAAGGAGCAAGAGGG - Intergenic
1144693906 17:17288268-17288290 GAGGGGGAGGAGGATGCTGAAGG + Intergenic
1144746787 17:17621370-17621392 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
1145095400 17:20021162-20021184 GAGGGGGAGGAGGAAGAAGAGGG + Intronic
1145268398 17:21391587-21391609 GAGGAGGAGGAGGAGGAAGAGGG - Intronic
1145829897 17:27907459-27907481 CAGAGGAAAGAGGGAGAAGATGG + Intergenic
1145983410 17:29027838-29027860 CAAGGGAAGGAGGGGGAAAATGG - Intronic
1145994453 17:29097409-29097431 GAGGGGAAGGAGGATGGGGCAGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146497159 17:33333137-33333159 CAAAGGCAGGAGCATGAAGAAGG - Intronic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1147165689 17:38592054-38592076 CAGGGCAGGGAGGAGGAAGTAGG - Intronic
1147312070 17:39601349-39601371 CAGGGGAGGGAGGAGGAAAGGGG - Intergenic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147453578 17:40520906-40520928 CGGGTGCAGGAGGATGGAGAGGG - Intergenic
1147498777 17:40942374-40942396 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1147523460 17:41197271-41197293 CAGGGGAAGGAGTGTGATGGGGG - Intronic
1147559289 17:41499146-41499168 GAGGGGAGGGAATATGAAGATGG + Intergenic
1147769376 17:42857027-42857049 CAGGAGGAGGAGGAGGAAGTAGG - Exonic
1147887396 17:43693432-43693454 CCCGGGAGAGAGGATGAAGAGGG + Intergenic
1147899542 17:43774988-43775010 CAGGGGGAGGAAGATGGAGAAGG + Intronic
1147977200 17:44254692-44254714 CAAGGGCAGGAGGATGGGGAAGG + Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148385993 17:47235544-47235566 CAGGGGAAGTATGCAGAAGAGGG - Intergenic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1148488097 17:48004153-48004175 GCGGAGAAGGAGGAAGAAGACGG - Intergenic
1148559362 17:48597203-48597225 CAGAGGAGGGAGGAGGAATAAGG - Intronic
1148588720 17:48799504-48799526 GAGGGGATGGAGGGTGAAGGTGG - Intronic
1148806713 17:50267473-50267495 CTGGGGCCGGAGGAGGAAGAGGG + Intergenic
1148870842 17:50658113-50658135 CAGGGCAAAGTGGATGTAGAAGG - Exonic
1149598081 17:57875700-57875722 GAGGGGAAGGAGGGAGAAGCTGG + Intronic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1149625290 17:58075224-58075246 GAGGGGGAGGGGGATGGAGAGGG + Intergenic
1149991490 17:61385977-61385999 CTGGGGAGGGAGGCTGGAGAGGG + Intronic
1150095575 17:62371726-62371748 CAGGGGAAGGAGGGGGAATTTGG + Intronic
1150150901 17:62808235-62808257 TCGGGGAAGGAGGAGGAAGAGGG - Exonic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150602016 17:66659367-66659389 CTGGTGGAGGAGGAGGAAGAAGG - Intronic
1150628598 17:66859816-66859838 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
1150915979 17:69437384-69437406 AAGGAGGAGGAGGAAGAAGAGGG + Intronic
1150961171 17:69913984-69914006 TGGAGGAAGGAGGATGAACATGG + Intergenic
1150980198 17:70132765-70132787 CAGTGAAGGGAGGATGACGATGG + Exonic
1151197776 17:72444310-72444332 TAGGGAAAGGAGGATGAAAGGGG - Intergenic
1151224712 17:72639942-72639964 TACTGGAAGGAGGAGGAAGATGG + Intergenic
1151329238 17:73397118-73397140 CTGGGGAAGCAGGGTCAAGAGGG + Intronic
1151483654 17:74385147-74385169 CAGGGGAAGGAAAAGGAAAAGGG + Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152008498 17:77696852-77696874 GAGGGGAAGGAGGAGGAGAAGGG - Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152070283 17:78130866-78130888 CAGTGGAGGGAGAATGCAGAGGG + Intronic
1152294909 17:79461405-79461427 GCTGGGAAGGAGGAGGAAGATGG + Intronic
1152369593 17:79878095-79878117 CGGGGGGAGGAGGATGGGGAAGG + Intergenic
1152441369 17:80312260-80312282 CAGAGGGAGGAGGAAGGAGAGGG + Intronic
1152584275 17:81182105-81182127 CAGGGGAAGGAGGGTCCTGAGGG - Intergenic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152946271 17:83199151-83199173 GAGGGGCTGGAGGAGGAAGAGGG - Intergenic
1152982742 18:294262-294284 AAAGAGAATGAGGATGAAGAGGG - Intergenic
1153185246 18:2478889-2478911 GAGGAGGAGGAGGAAGAAGAGGG + Intergenic
1153185250 18:2478905-2478927 AAGAGGGAGGAGGAGGAAGAAGG + Intergenic
1153955253 18:10090645-10090667 AAGGAGAAGGAAGAAGAAGAGGG - Intergenic
1154006828 18:10537484-10537506 GAGGAGGAGGAGGAAGAAGAGGG + Intronic
1154026876 18:10716245-10716267 GAGGAGGAGGAGGAAGAAGAGGG - Intronic
1154082507 18:11272419-11272441 CAGGGGAAGATGGAAGAAAATGG + Intergenic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1154484813 18:14865222-14865244 CAGTGGGAGAAGGATAAAGAGGG - Intergenic
1154976029 18:21458655-21458677 GAGGGGAGGGAGGAGGAAAAAGG + Intronic
1155102499 18:22626174-22626196 CAGAGGAAGAAAGATGAAGGGGG + Intergenic
1155404999 18:25478119-25478141 CAGGGGAAGGAGGAGGTTTACGG - Intergenic
1155583903 18:27343098-27343120 CAGGGGAATTAGGTTGCAGAAGG - Intergenic
1155846912 18:30719296-30719318 CAGGGGAAGGGTGATTCAGAAGG + Intergenic
1155871059 18:31028866-31028888 CAGGGAGATGAGGCTGAAGAGGG - Intronic
1156140283 18:34100353-34100375 CAGGGGAAAGAGGTAGGAGATGG - Intronic
1156233121 18:35174422-35174444 GAGGGGGAGGGGGATAAAGAGGG - Intergenic
1156263010 18:35461979-35462001 TTGGGGTGGGAGGATGAAGAAGG - Intronic
1156574369 18:38297396-38297418 GAGGGGATGGGGGATAAAGAAGG + Intergenic
1156598846 18:38579821-38579843 AAGGAGAAGGAGGAGGTAGAAGG + Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1156860491 18:41830318-41830340 CAATGTAAGGAAGATGAAGATGG + Intergenic
1157034496 18:43954643-43954665 CAGGGGAAGGAGTATGTACAAGG - Intergenic
1157132204 18:45017252-45017274 GAGTGGAAGGAGGATGAAACTGG + Intronic
1157186969 18:45549046-45549068 CATAGGAAGGAGGATGGAGGAGG - Intronic
1157232296 18:45929016-45929038 GGGGGGAAGGGGGAAGAAGATGG + Intronic
1157415678 18:47500774-47500796 CAGGGAAACAAGGATGAAGGGGG + Intergenic
1157551227 18:48583053-48583075 GAGGGGAGGGAGGAGGATGATGG + Intronic
1157731959 18:50011694-50011716 GAGGGAAAGGAGGAGGAACAGGG - Intronic
1157768664 18:50325135-50325157 AAGGAGAAGGAGGAGGAAGGAGG - Intergenic
1157867297 18:51197512-51197534 CAGGGGAAGGAGGCAGAGGTAGG + Intronic
1157911754 18:51623131-51623153 CAGGGGCTGGAAGATGAGGAAGG + Intergenic
1158411257 18:57208110-57208132 CAGGGCAAAGAGGATAAAGGAGG + Intergenic
1158523022 18:58187412-58187434 CCGGGGAAGAAGGAGTAAGAAGG + Intronic
1158624038 18:59056579-59056601 CAGGGGAGAGAGGATCGAGAAGG - Intergenic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1158764899 18:60438061-60438083 TAGGGAGAGGAGGATAAAGAGGG - Intergenic
1158859699 18:61580434-61580456 CAGGGGAAGGGGAAAGGAGAAGG - Intergenic
1159226528 18:65544839-65544861 GAGGGCAAGGAGGAAGCAGAAGG - Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159872824 18:73777665-73777687 AAGGGGAAAGAGGAAGAAAATGG + Intergenic
1159880904 18:73857642-73857664 CAGAGGGATGAGGATGGAGAAGG + Intergenic
1159962845 18:74568775-74568797 AAGGGATGGGAGGATGAAGAAGG + Intronic
1160173994 18:76578676-76578698 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160173999 18:76578694-76578716 GAGGGGAAGGAAGAAGATGAGGG - Intergenic
1160174003 18:76578712-76578734 GCGGGGAAGGAGGAAGAGGAGGG - Intergenic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160174579 18:76582225-76582247 GAGGGGAAGGAGGAAGACGAGGG - Intergenic
1160676393 19:393622-393644 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676398 19:393647-393669 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676423 19:393745-393767 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676438 19:393799-393821 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676443 19:393824-393846 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676448 19:393849-393871 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676453 19:393874-393896 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676458 19:393899-393921 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676476 19:393967-393989 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676481 19:393992-394014 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676615 19:394562-394584 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676624 19:394600-394622 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676629 19:394625-394647 GAAGGGAAGGATGATGGAGAAGG + Intergenic
1160676653 19:394738-394760 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676658 19:394760-394782 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676678 19:394848-394870 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676683 19:394870-394892 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676708 19:394980-395002 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676728 19:395069-395091 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676754 19:395181-395203 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676779 19:395281-395303 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160676804 19:395381-395403 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160695271 19:480930-480952 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160695314 19:481157-481179 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160695365 19:481408-481430 GATGGGAAGGATGATGGAGAAGG + Intergenic
1160941388 19:1621909-1621931 GAGGAGAAGGAGGATGCAGATGG + Exonic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1161027993 19:2045515-2045537 GAGGAGAAGGAGGAAGAAGAGGG - Intronic
1161347153 19:3774165-3774187 CAGAGGAAGGAAGCTGGAGAGGG + Intergenic
1161370534 19:3908640-3908662 AAGGGGAAGGGGGAGGAAGAAGG - Intronic
1161370600 19:3908840-3908862 GAGGAGAAGGAGGAGGAAGGGGG - Intronic
1161433238 19:4246526-4246548 CTGGGGAAGGAGGCTGGGGAAGG + Intergenic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161544821 19:4874060-4874082 CAGGGGAAAAAAGATGAAGCTGG + Intergenic
1161607352 19:5222443-5222465 AAGGTGGAGGAGGAGGAAGAGGG + Intronic
1161837035 19:6654796-6654818 GAGGAGGAGGAGGATGGAGAGGG - Intergenic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161866018 19:6832648-6832670 GAGGAGGAGGAGGAGGAAGAAGG - Intronic
1161873934 19:6892967-6892989 GTGGGGAAGGGGGATAAAGAGGG - Intronic
1161934343 19:7362297-7362319 AAGGAGAAGGAGGAAGAAGAAGG + Intronic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162024221 19:7884587-7884609 GAGGAGAGGGAGGAGGAAGATGG + Intergenic
1162024241 19:7884632-7884654 GAGGAGAGGGAGGAGGAAGATGG + Intergenic
1162024260 19:7884677-7884699 GAGGAGAGGGAGGAGGAAGATGG + Intergenic
1162032841 19:7924902-7924924 CAGGGGAGGGAGGAGGGACAAGG + Exonic
1162727572 19:12699314-12699336 CAGGGGGAAGAGGGTGAGGAGGG + Exonic
1162873472 19:13603174-13603196 GAGGAGGAGGAGGAAGAAGAGGG + Intronic
1162968430 19:14166532-14166554 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1163276108 19:16285319-16285341 GAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1163361632 19:16850619-16850641 CAGGGGAAGGCGGAGTACGATGG + Intronic
1163611552 19:18304451-18304473 GAGGGGAATGGGGAGGAAGATGG + Intergenic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164347329 19:27282546-27282568 CAGGGGAATTAGGCAGAAGAAGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164957809 19:32402187-32402209 CAGGAGGAAGAGGAAGAAGAAGG + Intergenic
1164972803 19:32546892-32546914 TAGGAGGAGGAGGAAGAAGAGGG - Intergenic
1165067469 19:33237406-33237428 CAGGGGCAGGTGGAGGACGAGGG - Intergenic
1165333516 19:35154396-35154418 CTGGGGGAGGAGAATGAAGAGGG - Intergenic
1165348302 19:35262579-35262601 CAGGAGGAGGAAGATGAGGAAGG - Exonic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165416072 19:35694257-35694279 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1165468764 19:35990802-35990824 TAGGAGAAGGAGGAGGAAGGAGG + Intergenic
1165730618 19:38142539-38142561 CAGGGGAGGAAGGAGGCAGAGGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165883262 19:39058419-39058441 CTTGGGAGGGAGGCTGAAGAAGG - Intergenic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166072236 19:40394267-40394289 GAGGAGGAGGAGGAGGAAGAGGG - Exonic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166881041 19:45930289-45930311 CAGAGGAAGGAGAATAGAGATGG - Intergenic
1166944697 19:46389854-46389876 GAGGGGCAGGAGGATGGGGATGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167608200 19:50492902-50492924 GAGGGAAAGGAGGAGGAAGGAGG + Intergenic
1167621631 19:50564012-50564034 CAAGGGAAGGAGAGTGGAGAGGG + Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167686528 19:50960082-50960104 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167686535 19:50960100-50960122 GAGGGGGAGGAGGATGGAGAGGG + Intronic
1167686544 19:50960118-50960140 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167749430 19:51370944-51370966 CGGGGGATGGAAAATGAAGAGGG - Intergenic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168189347 19:54726557-54726579 CAGGGGACTGAAGAGGAAGATGG + Intronic
1168340442 19:55620305-55620327 CATAAGAATGAGGATGAAGAAGG + Intergenic
1168375149 19:55870789-55870811 CACGAGAAGGAGAGTGAAGAGGG - Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
1168501905 19:56899955-56899977 GAAGGGAAGGAGGAAGGAGAAGG + Intergenic
1168510160 19:56967369-56967391 GAGGAGAAGGAGGAGAAAGAGGG - Intergenic
925590369 2:5503279-5503301 CAGGGGGTGGAGGAAGAAAATGG - Intergenic
925680346 2:6414452-6414474 CTTGGGCAGGAGCATGAAGAGGG + Intergenic
925732939 2:6935182-6935204 AACAGGAAGGAAGATGAAGATGG - Intronic
925927586 2:8681666-8681688 GAGGGGAAGGAGGAGGGAGAAGG - Intronic
926117355 2:10221821-10221843 CAGGGTGATGATGATGAAGATGG + Intergenic
926129930 2:10296601-10296623 CAGTGGGAGGATGATGATGAGGG + Intergenic
926215161 2:10901808-10901830 GTGGGGAAGGGGGATGATGAGGG + Intergenic
926309799 2:11667276-11667298 AAGGGGAAAGAGGCTGGAGAGGG - Intronic
926327088 2:11794718-11794740 CAGGCAAAGGAGGACGGAGATGG - Intronic
926741749 2:16117064-16117086 CAGGGGAAGGTGGGTGAGAAGGG - Intergenic
926935748 2:18085379-18085401 CAGAGGAAGGAGGATGCCAAGGG + Intronic
926974990 2:18505951-18505973 AAGGGAGAGGAAGATGAAGAGGG + Intergenic
927433034 2:23042937-23042959 GATGGGAAGGAGGATGAAGAGGG - Intergenic
927467263 2:23346884-23346906 CATGGGAAGGAGGCTGACCAGGG + Intergenic
927678986 2:25127772-25127794 CAGGGGGAGGCGGATCCAGAGGG - Intronic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
927973902 2:27323297-27323319 AAGGGGCAGGAGGAGGCAGAGGG - Intronic
928105843 2:28470094-28470116 GAGGGGGAGGGGGAGGAAGAGGG + Intronic
928246919 2:29638495-29638517 CAGGGCAAGGATGATGGAGTAGG + Intronic
928361088 2:30662885-30662907 CAGGTGCAGGAGGAGGAATAGGG + Intergenic
928536302 2:32244868-32244890 GAGGGGAAGGGAGAGGAAGAAGG + Intronic
929015015 2:37485260-37485282 AAGAAGAAGGAGGAAGAAGAAGG - Intergenic
929078180 2:38095822-38095844 CATGGGAAGAAACATGAAGACGG + Intronic
929092090 2:38228925-38228947 GAGGAGAAGGAGGGAGAAGAAGG + Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929408407 2:41669177-41669199 TAGGGAAAGGAGGAGGAAGGAGG - Intergenic
929777829 2:44939470-44939492 AAGGGGCAGGAGGAGGAAGCGGG - Intergenic
929872592 2:45771600-45771622 AAGGGGGAGGAAGAGGAAGATGG - Intronic
930084053 2:47480196-47480218 GAAGGGAAGGAGGAAGAGGAGGG - Intronic
930422688 2:51174541-51174563 AAGGAGAAGGAGGATAAAGTTGG + Intergenic
930668523 2:54123627-54123649 CAGGGGATGGAGGAAGAAGTGGG - Intronic
930769794 2:55119929-55119951 CAGATGCAGGAGGGTGAAGATGG + Intergenic
931189689 2:59988230-59988252 CAAGGGAAGGGGGATAAGGATGG + Intergenic
931340731 2:61398468-61398490 CGGGGGAAGGAGGCGGAAGCGGG + Intronic
931340737 2:61398487-61398509 CGGGGGAAGGAGGCGGAAGCAGG + Intronic
931340744 2:61398506-61398528 CAGGGGAAGGAGGCGGAAGCGGG + Intronic
931340757 2:61398543-61398565 CGGGGGAAGGAGGCGGAAGCGGG + Intronic
931376389 2:61712179-61712201 CAGAGGAGAGAGGATGATGATGG - Intergenic
931647953 2:64442367-64442389 CATGAGAAAGAGGGTGAAGAAGG - Intergenic
931992797 2:67807892-67807914 CAAGTGGAGGAGGAGGAAGAAGG - Intergenic
932208165 2:69902298-69902320 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
932407289 2:71521980-71522002 GGAGGGAAGGTGGATGAAGATGG - Intronic
932442148 2:71744214-71744236 CTGAGGAAGGAGCATGCAGAAGG - Intergenic
932539411 2:72636425-72636447 AAGAGGAGGGAGGAGGAAGAAGG + Intronic
932585467 2:73025307-73025329 CAGAGGTGGGAGGATGCAGAAGG - Intronic
932660114 2:73644307-73644329 CACAGGGAGGAGGATGAGGAAGG + Intergenic
932666681 2:73703988-73704010 CACAGGGAGGAGGATGAGGAAGG + Intergenic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932796393 2:74699659-74699681 CAAGGGTAGGTGGAGGAAGATGG + Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932883017 2:75521732-75521754 CTGGGGAAGGATGATGGTGATGG + Intronic
933425998 2:82112794-82112816 CAGGAGAGGGAGCATGTAGATGG - Intergenic
933441107 2:82315400-82315422 GAGGGGGAGGAGAAGGAAGAGGG - Intergenic
934793009 2:97078907-97078929 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
934813178 2:97301578-97301600 CAGAGGATGGAGGGTGAGGAGGG + Intergenic
934824517 2:97406902-97406924 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935237952 2:101153499-101153521 AAGGTGGAGGAGGGTGAAGAGGG + Intronic
935294239 2:101634951-101634973 CTGGGGAAGGAGGAGGCAGGTGG - Intergenic
935424746 2:102908286-102908308 CAGGGGTGGAAGGATGAAGTGGG + Intergenic
935727135 2:106033398-106033420 CAGGGGATTGGGGAAGAAGAGGG + Intergenic
935874806 2:107494804-107494826 CAGGGGATGGAGGAAGTTGAGGG + Intergenic
935889406 2:107659566-107659588 GAGGAGAAGGAGGAAGAAAAGGG + Intergenic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936500244 2:113060984-113061006 CAGGGGAGGGGGCCTGAAGAGGG + Intronic
936805067 2:116321406-116321428 CTGGGAAAGGAGGGTGGAGAAGG + Intergenic
936855119 2:116948358-116948380 GAGGGGAAGGAGGGAGAGGAGGG + Intergenic
937331047 2:121030313-121030335 AATGGGAGGGAGGATGATGAAGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937947309 2:127352684-127352706 GAGGGGGAGGAGGAGGGAGAGGG - Intronic
938131032 2:128715687-128715709 CAGGAGGAGGAGGATAAACAGGG + Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938542507 2:132296165-132296187 GAAGGGAAGAAGGAGGAAGAGGG - Intergenic
938671969 2:133595372-133595394 GAGGAGGAGGAGGAAGAAGAAGG - Intergenic
938688205 2:133761880-133761902 CAGAGGAAAGAAGATGAAAATGG - Intergenic
939025186 2:137004253-137004275 CACGGGAAGGAGGATGAAGGTGG - Intronic
939095137 2:137825620-137825642 AAGGGGAAGGAGTAAGAATATGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939822167 2:146970536-146970558 CAGGAGGAAGAGGGTGAAGAGGG + Intergenic
939983219 2:148805651-148805673 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941672519 2:168310326-168310348 AAGGGGAAGGAAGAGCAAGAAGG - Intergenic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
941753530 2:169160465-169160487 GAGGAGAAGGAAGAAGAAGAAGG + Intronic
941809250 2:169739032-169739054 AAGGAGGAGGAGGAAGAAGAAGG - Intronic
942978141 2:182044103-182044125 CAGGTGATGGATGATGAAGGTGG - Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943365703 2:186965779-186965801 GTAGGGAAGAAGGATGAAGAGGG + Intergenic
943725903 2:191251088-191251110 CTGGGGAAGGAGAATGACGCAGG - Intronic
943726528 2:191257034-191257056 AAGGGGAAGGGGGAGGAAGAGGG - Intronic
943793681 2:191965232-191965254 CAGGGGAAGGAAGTGGGAGAAGG - Intronic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
943890257 2:193277272-193277294 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
944048977 2:195445102-195445124 CGGGGGGAGGAGGATAAAAAAGG - Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944328280 2:198433210-198433232 GAAGTGAAGGAGGAGGAAGAGGG + Intronic
944402559 2:199345061-199345083 CAGGTGGAGAAGGAAGAAGAGGG - Intronic
944516814 2:200520844-200520866 CAGGGGAATGAGGTTGGAGGGGG - Intronic
944949880 2:204736422-204736444 CAGGAGGAGGAGGATGAAAGGGG - Intronic
945225951 2:207530655-207530677 TGGGGGATGGAGGAGGAAGAAGG + Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945416320 2:209577346-209577368 CTGGGGAGAGAGGATGATGATGG + Intronic
946051630 2:216867603-216867625 AAGGAGAAGGAAGAGGAAGAGGG - Intergenic
946148806 2:217750323-217750345 GAGGAGGAGGAGGAAGAAGAGGG + Intronic
946303302 2:218839255-218839277 GAGGAGGAGGAGGAGGAAGAAGG - Intergenic
946693975 2:222333627-222333649 TAGGGGAAGGGGGATGGAGCCGG - Intergenic
946878829 2:224157622-224157644 CAGGGGAGTGAGGAAGAAGGTGG + Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
947005415 2:225505881-225505903 AATGGGAAGAAGGATGAAGCAGG + Intronic
947536289 2:230942280-230942302 CAGGAGAAGGAGGCAGAAGAAGG - Intronic
947805295 2:232962473-232962495 CAGGAGATGGAGGTTGAAGGGGG + Intronic
947909272 2:233790699-233790721 GAAGGGAGGGAGGATGGAGAAGG - Intronic
947943035 2:234075586-234075608 CAGGGGCAGCAGGAAGAAGCCGG - Intronic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948091867 2:235301991-235302013 AGGAGGCAGGAGGATGAAGAGGG - Intergenic
948091955 2:235302235-235302257 AAGAGGAGGGAGGAGGAAGAGGG - Intergenic
948117833 2:235506769-235506791 CACAGGAAAGAGGATGAACATGG - Intronic
948291501 2:236828349-236828371 GAAGGGAAGGAGGCAGAAGATGG + Intergenic
948483311 2:238263979-238264001 GAGGGGGAGGAGGAAGAGGAGGG + Intronic
948670470 2:239565209-239565231 GGTGTGAAGGAGGATGAAGAAGG + Intergenic
948759895 2:240183945-240183967 GAGGGAAGGGAGAATGAAGAGGG + Intergenic
948923806 2:241081385-241081407 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
949012666 2:241690112-241690134 ACGGGGGAGGAGGGTGAAGATGG + Intergenic
949077934 2:242073269-242073291 CCGGTGAAGGGGAATGAAGAAGG + Intergenic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168926762 20:1588038-1588060 CAGGGGAGGGAGGATCATGGGGG + Intronic
1168992626 20:2107618-2107640 CAGGGGAAGGAAGAAGCTGAGGG + Intronic
1169027537 20:2383329-2383351 CAAGGGCAGGAGGAGGAAGATGG + Intronic
1169074119 20:2751028-2751050 AAGGGGAAGGAGGAGGAGAAGGG + Intronic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169340967 20:4795845-4795867 CAGGAGGAGGAGGATGGAGGGGG + Exonic
1169798052 20:9486258-9486280 TAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1170032708 20:11959360-11959382 GAGGGGAAGGAGGGTGGAGGAGG + Intergenic
1170206360 20:13802861-13802883 TAGTGGAGGGAGGAAGAAGAGGG - Intronic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1171183911 20:23111387-23111409 CAGGGGAAGGGAGATGGGGAAGG + Intergenic
1171217879 20:23365290-23365312 GAGGAGGAGGAGGACGAAGAAGG + Exonic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171459491 20:25290891-25290913 CAGGGGAGGGAGGATACAGAGGG - Intronic
1171459521 20:25290984-25291006 CAGGGGAGGGAGGGTACAGAGGG - Intronic
1171937360 20:31287614-31287636 CAGAGGAAGGGGGATGAAAATGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172292206 20:33784321-33784343 GATGGGAAGGAGGAGGGAGAAGG - Intronic
1172292227 20:33784388-33784410 CAGGGGAGGGAGGCTGGAGGGGG - Intronic
1172413089 20:34741017-34741039 GAGGGGAAGGAAGCTGAACAGGG + Exonic
1172520393 20:35562071-35562093 CTGGGGGATGAGGATGAAGGTGG + Intergenic
1172525323 20:35597499-35597521 CAGGGGAAGGAGGATGATGGTGG - Intergenic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1172703311 20:36865231-36865253 AATGGGCAGGAGGAAGAAGAGGG - Intergenic
1172975410 20:38902589-38902611 CAGGGGAAGGCAGATGAGGGAGG - Intronic
1173002086 20:39111749-39111771 GAGGGGCAGGGGGAGGAAGAGGG + Intergenic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173322163 20:41997992-41998014 GAGGGCAAGGAGGAAGAAGAGGG - Intergenic
1173537689 20:43828563-43828585 AAAGGGAAGGAGGCTGGAGAAGG + Intergenic
1173630433 20:44509976-44509998 CAGCTGAATGAGGATGAAGAGGG + Exonic
1173798424 20:45878909-45878931 CAGGGGCTGGGGGAGGAAGAGGG - Exonic
1174012862 20:47464667-47464689 CAGGGGAAGGAGAATGGAAAAGG - Intergenic
1174179094 20:48663792-48663814 CAGGGGAAGGAGGATATGGCTGG - Intronic
1174292586 20:49519542-49519564 CAGGCGAGGGTGGGTGAAGAAGG - Intronic
1174405148 20:50298059-50298081 CATGGGAGGGTGGATGGAGAGGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174742426 20:53028244-53028266 CAGGTGAAGGGGGATGTAGTGGG - Intronic
1174960501 20:55151686-55151708 CAGCAGTAGGAGGAGGAAGAAGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175120155 20:56710808-56710830 GAGGGGAAGGAGGAGGGAAAGGG - Intergenic
1175120180 20:56710883-56710905 GAGGGGAAGGAGGAGGGAAAGGG - Intergenic
1175120206 20:56710958-56710980 GAGGGGAAGGAGGAGGGAAAGGG - Intergenic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175335775 20:58195322-58195344 CAGGCGATGGAGGAGGAAGCTGG + Intergenic
1175452103 20:59077955-59077977 GAGGGGGAGGAGGAAGAGGAAGG + Intergenic
1175523427 20:59617809-59617831 GAAGGGAAGGAGAAAGAAGAAGG - Intronic
1175711774 20:61227123-61227145 TAGGGGAAGGAGGATTGAGTGGG - Intergenic
1175941060 20:62537707-62537729 CAGGGAAGGGAGGAAGGAGAGGG + Intergenic
1176021290 20:62963619-62963641 CCAGGAGAGGAGGATGAAGAAGG - Exonic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176264778 20:64203508-64203530 GAGGGGAAGAGGGAGGAAGAGGG - Intronic
1176367536 21:6043069-6043091 AAGGGGAAGAATGATGGAGACGG - Intergenic
1176720411 21:10388120-10388142 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1176796514 21:13374253-13374275 CAGTGGGAGAAGGATAAAGAGGG + Intergenic
1176993444 21:15525172-15525194 AATGGGGAGGAGGAGGAAGAAGG - Intergenic
1177231251 21:18322730-18322752 GTGGGGAGGGAGGATAAAGAAGG + Intronic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177758261 21:25373584-25373606 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177801783 21:25835107-25835129 CAGGGGTAGAGGGGTGAAGAGGG - Intergenic
1178496554 21:33090859-33090881 CAGGGGAAGGAAGATAAGGCAGG + Intergenic
1178643207 21:34363381-34363403 AAGAGGAAGAAGGAAGAAGAAGG - Intergenic
1178713177 21:34938535-34938557 GAGAGGGAGGAGGAAGAAGAAGG - Intronic
1178767484 21:35467975-35467997 GAGGAGGAGGAGGAGGAAGAAGG - Intronic
1178873808 21:36397081-36397103 CAGGTCAGGCAGGATGAAGAGGG - Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179403091 21:41102415-41102437 CTGGGGAAGCAGGACGAAGCTGG + Intergenic
1179415994 21:41199278-41199300 CAGGTGGAGGAAGATGAGGAAGG - Intronic
1179755983 21:43495473-43495495 AAGGGGAAGAATGATGGAGACGG + Intergenic
1180147175 21:45928126-45928148 CGGGGGCAGGAGGAGGAAGCAGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180462265 22:15575925-15575947 GAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1180728848 22:17966221-17966243 CAGGGAAAGTGGGATGAAGCTGG - Intronic
1181035191 22:20166586-20166608 CAGCTGCAGGGGGATGAAGAAGG + Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181348765 22:22240415-22240437 CAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1181452595 22:23033914-23033936 CAGGGGAGCAAGGATGAAAATGG + Intergenic
1181508997 22:23380539-23380561 CAGGGGCAGGAGGAGGGACAGGG - Intergenic
1181528065 22:23501427-23501449 GAGGAGAAGGAGGAGGCAGAAGG + Intergenic
1181659676 22:24335000-24335022 CATGGGGAGAAGGCTGAAGATGG - Intronic
1181857001 22:25789091-25789113 GAGGAGGAGGAGGAAGAAGAAGG - Intronic
1181977198 22:26738428-26738450 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1182303564 22:29352505-29352527 CATGGGAAGGAGGAGGTACAAGG + Intronic
1182322735 22:29489084-29489106 GAGGGCAAGGAGGAAGAAGGGGG + Exonic
1182431950 22:30304467-30304489 CTTGGGGAGGAGGAGGAAGAGGG - Intronic
1182755881 22:32678546-32678568 AAGGAGGAGGAGGATGAAGGAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1182985889 22:34715823-34715845 GAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1183146328 22:35995879-35995901 CAGGAGGAGGAGGAGGAAAAGGG - Intronic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1183784865 22:40023437-40023459 GAGGGGAAGGAGGTGGAAGAGGG + Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184456679 22:44614868-44614890 GAAGGGGAGGAGGAGGAAGAGGG - Intergenic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184561642 22:45267267-45267289 GAGGGGAGGGGGGATGAAGAGGG + Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184959363 22:47917900-47917922 AAGGAGAAGGAGGAAGGAGAGGG - Intergenic
1185089383 22:48757251-48757273 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185089412 22:48757352-48757374 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185109067 22:48890694-48890716 CAGGGGAGGGAAGATGGAGGTGG + Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949628125 3:5891088-5891110 CAGAGGAATTAGGATGAAGATGG - Intergenic
949707362 3:6834401-6834423 GAGGGGGAGGAGGAGGGAGAGGG + Intronic
949994758 3:9607925-9607947 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
950093716 3:10315748-10315770 GAGAGGATGGAGGAAGAAGAGGG - Intronic
950122190 3:10489206-10489228 CAGATGAAGGGAGATGAAGAGGG - Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950168894 3:10822588-10822610 CAGGGGAGGGAGGTTGGGGAAGG + Intronic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950773691 3:15332320-15332342 GAGGAGGAGGAGGAGGAAGAGGG - Exonic
950890522 3:16400305-16400327 CAGGGGAGGGAGGGTGGAGGTGG - Intronic
951234852 3:20222404-20222426 CAGGGGCAGGACAATGAATAAGG - Intergenic
951352249 3:21620263-21620285 CAGAGGAAGGATGCTTAAGATGG + Intronic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
951494373 3:23309906-23309928 TAGAGGAAGGTGGAGGAAGATGG + Intronic
952002350 3:28800646-28800668 AAGGGAGAGGAGGAGGAAGAAGG - Intergenic
952288131 3:31987966-31987988 TAAGGGAAGGATGATTAAGAGGG + Intronic
952651271 3:35729462-35729484 AAGTGGAAGGAGGATGTAGCTGG - Exonic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953142043 3:40238145-40238167 GAAGGGAAGGAGAAGGAAGAAGG - Intronic
953243259 3:41168092-41168114 CAGACGAGGGAGGAAGAAGAAGG + Intergenic
953365420 3:42340458-42340480 GAGGGGGAGGAGGAGGAGGAGGG + Intergenic
953405812 3:42659256-42659278 GAGGAGGAGGAGGAGGAAGAGGG + Exonic
953499990 3:43424037-43424059 TGGGGGAATGAGGATGATGAGGG - Intronic
953813649 3:46135266-46135288 CAGGGGTAGGAGTGTGATGACGG - Intergenic
954272173 3:49518544-49518566 CAGGGTCAGGAGAATAAAGAAGG + Intronic
954813464 3:53262397-53262419 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
955340765 3:58123399-58123421 CACGGGAAGGTGGGTGAAGCTGG + Exonic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
956191220 3:66610280-66610302 CAGGGGCAGGAGGATGTGCATGG + Intergenic
956798895 3:72739304-72739326 TGGGGGAAGGAAGATGAGGAGGG - Intergenic
956804490 3:72795619-72795641 TAGAGGAAGGAGGGTGCAGAGGG + Intronic
956839043 3:73120286-73120308 CAGGGGACGGAGGTTGCAGTAGG - Intergenic
956846536 3:73188825-73188847 GAGGGGGAGGAGGAGGAAGAAGG - Intergenic
956846548 3:73188870-73188892 CAGGAGAAGGAGGAGGAAAGAGG - Intergenic
957163221 3:76636907-76636929 GAGGGGAAGGAGGACAAAGTGGG + Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957426780 3:80050721-80050743 CAGGAGGAGGAGGAGGTAGAAGG + Intergenic
957523038 3:81345570-81345592 AAGGGGAAGGTGGATGGAGATGG + Intergenic
957568343 3:81913428-81913450 CAGGAGGACAAGGATGAAGAGGG + Intergenic
957981930 3:87521273-87521295 CACTGGAAGGAGTATGAAAATGG - Intergenic
958033254 3:88139770-88139792 GAGGAGGAAGAGGATGAAGAAGG + Exonic
958208187 3:90432644-90432666 CAGGGCAATGAGGCAGAAGAAGG - Intergenic
958427982 3:94001535-94001557 CAAGGGAAGGAAGGTGAAAAAGG - Intronic
958589531 3:96137148-96137170 CAGGGGTAGGAGGTTAGAGATGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959014940 3:101123168-101123190 GTAGGGAAGGAGGAAGAAGAGGG + Intergenic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959818028 3:110699021-110699043 GAGGAGGAGGAGGAAGAAGAGGG + Intergenic
960394302 3:117117499-117117521 CAAGAGAATGAGGAAGAAGAAGG + Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
960799660 3:121525418-121525440 CAAGGTAAAGATGATGAAGATGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961317877 3:126052768-126052790 CATGGTCAGGAGGAAGAAGAGGG - Intronic
961523786 3:127483824-127483846 AAGAGGAGGGAGGAGGAAGAGGG + Intergenic
961801730 3:129455911-129455933 GAGGAGGAGGAGGAGGAAGAGGG + Intronic
962522048 3:136206500-136206522 CAGAGGAAGGAGGGTGAAAGAGG - Intergenic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
963032629 3:140993813-140993835 GAGGAGGAGGAGGAGGAAGAAGG - Intergenic
963896049 3:150686104-150686126 CTGGGCAAGGAGGATGATGGTGG - Intronic
964165699 3:153702698-153702720 GAGGAGAAGGAAGAAGAAGAAGG - Intergenic
964653918 3:159045054-159045076 GAGAGGAAGGAGAATGAAGTTGG - Intronic
964762000 3:160143026-160143048 CAGGGGCTGGAGAAGGAAGAGGG + Intergenic
965039519 3:163488626-163488648 CAGGAGAAAGAGGAAGAAGGGGG + Intergenic
965980155 3:174680759-174680781 AAGGAGAAGGAGGAGCAAGATGG + Intronic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966908476 3:184544503-184544525 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
967298752 3:187991320-187991342 CAGGTGAAAGAGCATGAAGCTGG - Intergenic
967553829 3:190831508-190831530 TAGGGAAAGGAGGGGGAAGAAGG - Intergenic
968174580 3:196538249-196538271 GAGGAGGAGGAGGAGGAAGAAGG - Intergenic
968181910 3:196601681-196601703 AAGGGAAAGGAGGAGGAAGCTGG - Intergenic
968565773 4:1311953-1311975 GAGAGGAAGGAGGATGGTGAGGG - Intronic
968612776 4:1564607-1564629 CAGGGGAAGGTGCTTAAAGAAGG + Intergenic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
968869947 4:3236690-3236712 CAGCGGCAGGAGGATGAAGGTGG + Intronic
968896330 4:3406073-3406095 GAGGGCCAGGAGAATGAAGATGG - Intronic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969173763 4:5384132-5384154 GAGTGGAAGGAGGATGGAGGGGG + Intronic
969253103 4:5982853-5982875 CAGGGAGAGGTGGATGAAGAAGG + Intronic
969257239 4:6010795-6010817 CAGGGGAAGGACGATGGGGCTGG - Intergenic
969275178 4:6129918-6129940 CAGGAGAAGGAGGCTGTTGAGGG - Intronic
969275237 4:6130198-6130220 CAGGGGAAGAAGGAGGGAGCGGG + Intronic
969315211 4:6377730-6377752 CAGGTGAAGGAGGATGGGCAGGG + Intronic
969364224 4:6684761-6684783 CAAGGGAAGGAGGAGGCAGGGGG + Intergenic
969454721 4:7294717-7294739 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969454792 4:7294899-7294921 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
970139231 4:12962426-12962448 AAGGGGAAGGGAGATGATGATGG - Intergenic
970757825 4:19447827-19447849 GAGGTGAAGGAGTATAAAGAGGG + Intergenic
970803943 4:20007727-20007749 CAGGGAAAGGAGGAATGAGAAGG + Intergenic
970814174 4:20134338-20134360 GAGAAGAAGGAGGAAGAAGAAGG + Intergenic
970814186 4:20134408-20134430 GAGAAGAAGGAGGAAGAAGAAGG + Intergenic
970914891 4:21321580-21321602 GAGGGGTAGGAGGAGGAAGAGGG + Intronic
971054980 4:22902179-22902201 GAAGGGAAGGAGGGTGCAGATGG + Intergenic
971376812 4:26062255-26062277 CAGGGACAGGAGGAAGAACAAGG + Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971570952 4:28210028-28210050 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971570959 4:28210046-28210068 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971615252 4:28781125-28781147 CAGAAGACTGAGGATGAAGATGG + Intergenic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
971662978 4:29444104-29444126 AAGGGAGAGGAGGAAGAAGATGG - Intergenic
972200134 4:36704051-36704073 TAGGAGAAAGAGGATGAAGTTGG + Intergenic
972371549 4:38428774-38428796 CAAGAGAAAGAGGATGAAGAAGG + Intergenic
972578669 4:40375599-40375621 GAGGGGAAAGAGGATGAGTATGG - Intergenic
972687371 4:41363698-41363720 GAGGGGAAGGGGGCTGAAGTGGG - Intronic
973265962 4:48210522-48210544 GAGGAGGAGGAGGAGGAAGAGGG + Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973708433 4:53602303-53602325 CAGGGGATGGAGGCTGAGAAAGG + Intronic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
973885611 4:55318020-55318042 GAGGGCAAGGAGGAAGAGGAAGG + Intergenic
973889749 4:55357138-55357160 CAGGGGACAGAGGGTGCAGAGGG - Intronic
974229253 4:59088889-59088911 GAGGGGGAGGAGGAGGAGGAAGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974686863 4:65242288-65242310 CATGGGATGGAGGCTGAGGAGGG - Intergenic
974686984 4:65243108-65243130 GAGGAGAAGGAGGAAGAAGAAGG + Intergenic
974876124 4:67705045-67705067 GGGGGTAAGGAGGATGAAAAAGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975456715 4:74599582-74599604 CAGGGGTGGGAGGAGGGAGAGGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975756980 4:77580755-77580777 GAGGGGAAGGAGGGAGAGGAGGG - Intronic
975948846 4:79743375-79743397 CAGGTCAATGAGGATGGAGAAGG - Intergenic
976341493 4:83950714-83950736 GAGGGGACGGTGGGTGAAGAGGG - Intergenic
976745818 4:88402048-88402070 CTGGGTAAGGAGGATGAAAGAGG + Intronic
976789248 4:88859291-88859313 CAGGAGAGGGAGGAGGAAGGAGG + Intronic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977317434 4:95467988-95468010 GAGGAGCAGGAGGATGAGGAGGG + Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977476165 4:97512646-97512668 TAGGGGTGGGAGGAAGAAGAAGG + Intronic
977628469 4:99215210-99215232 TAGGGGATGTAGGATGGAGAAGG + Intronic
977788524 4:101069699-101069721 GAGGAGAAGGAAGAGGAAGAGGG - Intronic
978036139 4:103997478-103997500 GAAGGGATGGGGGATGAAGAAGG - Intergenic
978052179 4:104215155-104215177 GAGGAGCAGGAGGAAGAAGAGGG + Intergenic
978264754 4:106810353-106810375 GAGGGGGAGGAGGAAGAGGAGGG - Intergenic
978355683 4:107870336-107870358 CAGGGGAGGGAGTTTGAAGTCGG + Intronic
978451046 4:108834210-108834232 AAGGGGAAGGTGGACAAAGATGG - Intronic
978535349 4:109756357-109756379 CAGGAGGAGGAGGAGGACGAGGG + Intronic
978797303 4:112721120-112721142 GAGAGGAAGGATGCTGAAGAAGG + Intergenic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
980191190 4:129527449-129527471 CAGAGGAAGGAGGATGGAGGTGG + Intergenic
980742570 4:136972059-136972081 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
981177128 4:141694611-141694633 CAAAGGAAGGAGGAAAAAGACGG - Intronic
981183200 4:141769934-141769956 CAGGGGAAGGAGGGTATATACGG - Intergenic
981414099 4:144467833-144467855 GAAGGGAAGGAGGCTGAAGTGGG + Intergenic
981666603 4:147234174-147234196 GAGAAGAAGGAGGAAGAAGAAGG + Intergenic
981761807 4:148202779-148202801 CAGAGGAAGGGGGATGAGGGGGG - Intronic
981809164 4:148753906-148753928 AAGGGGAAAGAGGGTGGAGAAGG - Intergenic
981922227 4:150097892-150097914 CAGGGAAAGGAGAATGAATATGG + Intronic
982092208 4:151890211-151890233 CAGCTGGAGGAGTATGAAGAAGG - Intergenic
982096813 4:151930867-151930889 CAGAGGAAGGGGGAAGCAGAGGG - Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982500237 4:156145110-156145132 TGGGGGAAGGAGGAAGAACAAGG + Intergenic
982637335 4:157913642-157913664 AAGGGGAAGGAGGGTGGAAATGG - Intergenic
982802648 4:159723264-159723286 CATGGGAGGGAGGCTGAAGGAGG - Intergenic
983072983 4:163291800-163291822 AAGGGGAAGGGGGAGGAAAAGGG + Intergenic
983344841 4:166515065-166515087 CAGGCTGAGGAGGAAGAAGAGGG + Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983552214 4:169029125-169029147 CAGGAGATGGAGGCTGCAGATGG + Intergenic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983743749 4:171168492-171168514 CAGTGGAAGGAATTTGAAGATGG + Intergenic
984070344 4:175103411-175103433 GAGGGGAGGGAGGAGGGAGAAGG + Intergenic
984070365 4:175103464-175103486 GAGGGGAGGGAGGAGGGAGAAGG + Intergenic
984456661 4:179977686-179977708 GAGGGAGAAGAGGATGAAGAGGG - Intergenic
984888484 4:184472656-184472678 CGGAGGGAGGAGGTTGAAGAGGG + Intronic
985026481 4:185744045-185744067 AAGGGGGAGAAGGAGGAAGAAGG - Intronic
985161478 4:187048857-187048879 CAGGAGAAGGGGAATGAAGGTGG + Intergenic
985385581 4:189444193-189444215 CAAGGCAAACAGGATGAAGAAGG - Intergenic
985951297 5:3223196-3223218 CAAGTGGAGGAGGATGAGGATGG - Intergenic
986183629 5:5416977-5416999 GAGGGGAAGGAGGACGGGGAGGG + Intergenic
986431440 5:7685040-7685062 TTGTGGGAGGAGGATGAAGAAGG - Intronic
986530214 5:8728526-8728548 CTTAGGAAGGAGGCTGAAGATGG + Intergenic
986567137 5:9126294-9126316 CATGGGCAGGAGGAATAAGACGG - Intronic
986707581 5:10464191-10464213 CAGAGGAAGGAGGAAAAAGAGGG - Intronic
986946656 5:13029269-13029291 AAGGGGAAGGGGGAAGAAGAAGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987093174 5:14525448-14525470 CATGGGAAGAAGGATGAGGCAGG - Intronic
987259670 5:16190460-16190482 AAGGGGAAGGAGAGTCAAGAAGG + Intergenic
987497615 5:18668677-18668699 CAAGGGAAGGTGGGGGAAGAAGG + Intergenic
987566412 5:19593670-19593692 GAAGAGAAGGAGGAGGAAGAAGG - Intronic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987985795 5:25144179-25144201 AAGGAGGAGGAGGAGGAAGAGGG + Intergenic
987987496 5:25166724-25166746 GAAGGGAAGGTGGAAGAAGATGG + Intergenic
988443726 5:31261208-31261230 GTGGGCAATGAGGATGAAGATGG - Intronic
988517431 5:31916989-31917011 GAGTGGAAGGAGGTTGATGAGGG + Intronic
988680707 5:33481219-33481241 AAGGGGAAGGGGAATGAAGGAGG - Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989608852 5:43272522-43272544 CAGGGGAAGGAAGGAGAAGGAGG + Intronic
989983164 5:50666903-50666925 GAGGGGGAGGAGGAGGAGGAGGG - Intronic
990194163 5:53294243-53294265 CTGGGGAGGGAGAATGAAAAAGG + Intergenic
990426069 5:55690437-55690459 GAAGGGAAAGAGGATGGAGAAGG + Intronic
990489419 5:56289460-56289482 CAGGCGAAGGAAAATAAAGAAGG - Intergenic
990500381 5:56390347-56390369 CTGGGGAAGGAGCATAAACACGG + Intergenic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
991057297 5:62334527-62334549 TAGGAGAAGGAAGAGGAAGAGGG - Intronic
991215568 5:64154843-64154865 CAGGAGAAGGTGGTTTAAGAGGG - Intergenic
991418754 5:66418898-66418920 GAGGAGGAGGAGGAGGAAGAAGG - Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992090638 5:73312922-73312944 GAGGAGAAGGAGGAAGAAGGAGG - Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992142102 5:73808830-73808852 GAGAAGAAGGAGGAAGAAGAAGG - Intronic
992215431 5:74520233-74520255 GAGGAGAAGGAAGAAGAAGAAGG + Intergenic
992427255 5:76670623-76670645 AAGGGGAAGGATGTGGAAGAGGG + Intronic
992564637 5:77985499-77985521 TGGGGGCAGGAGGATGGAGATGG + Intergenic
992846442 5:80753832-80753854 CAGTGGAAGGAGAAAGAACAGGG + Intronic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993164646 5:84336620-84336642 GAGGAGAAAGAGGTTGAAGAAGG + Intronic
993475365 5:88357760-88357782 TACAGGAAGGAGGATGGAGATGG + Intergenic
993519477 5:88883303-88883325 GAGGAGGAGGAGGAGGAAGAAGG + Intronic
993779252 5:92045344-92045366 GAGAGGAAGGAGGAAGGAGAGGG - Intergenic
994110765 5:96001357-96001379 CTGGGGAAGAAGAATCAAGAAGG + Intergenic
994665260 5:102697173-102697195 CAGGCCAAGGAGCACGAAGAAGG - Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995069670 5:107904934-107904956 CAGGAGGAGGAGGGTGAAGGTGG + Intronic
995385865 5:111588154-111588176 CAGGGGAAGGTGGAGTCAGAGGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995453043 5:112323674-112323696 CAGAGGAAGGAGGGCAAAGATGG - Intronic
996010138 5:118473153-118473175 CTGGGGAAGGAGGGTCAAGATGG - Intergenic
996611026 5:125380839-125380861 GAGGAGATGGAGGAAGAAGAGGG + Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
997064381 5:130544727-130544749 CAGAGGAAGGAGGATGCCAAGGG + Intergenic
997260638 5:132463257-132463279 CTGGGGAAGGAGGCTGTAGTTGG - Exonic
997410085 5:133684314-133684336 CTGGGGAGGGAGGGTGCAGAGGG + Intergenic
997465696 5:134086683-134086705 AAGGGGAAGGGGAAGGAAGAAGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997897828 5:137735789-137735811 CAGAGGAAGGAGGATTGAGAAGG - Exonic
998140425 5:139696925-139696947 CAGGGGAGGGTGCATGATGAGGG + Intergenic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998394726 5:141811462-141811484 AAGGGGAATGAGGAAGGAGATGG - Intergenic
999044839 5:148455921-148455943 GAGGAGGAGGAGGATGAAGAGGG + Intronic
999120282 5:149204408-149204430 GAGTGAAAGGAGGAAGAAGAGGG + Intronic
999182669 5:149681103-149681125 CAGGGGAGGGAGGAGGGAGGAGG - Intergenic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999533528 5:152489418-152489440 CAAGGGGAGAAGGTTGAAGAAGG + Intergenic
999672212 5:153967735-153967757 GAGGAGGAGGAGGAGGAAGAGGG + Intergenic
999784908 5:154882255-154882277 CAGTGGAAGGGGGAAGATGAGGG - Intergenic
999806595 5:155087117-155087139 CAGGTGACGTAGCATGAAGAAGG + Intergenic
999813960 5:155157003-155157025 GAAGTGAAGGAGGATGAAGTAGG - Intergenic
999835255 5:155363553-155363575 ATGGGGAAGGAGGAGAAAGATGG - Intergenic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000125214 5:158237273-158237295 CAGGGGAAGGTGTATGAATAAGG - Intergenic
1000253131 5:159513954-159513976 CAGACGAAGGAGGAAGGAGAAGG + Intergenic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1000349737 5:160343941-160343963 CAAGGGAAGCTGGATGGAGAGGG - Intronic
1000387403 5:160687823-160687845 CCGGGGCAGGAAGGTGAAGAGGG + Exonic
1000506500 5:162126652-162126674 AAGGGGAAGGTGGAGAAAGATGG - Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001056261 5:168452759-168452781 GAGGAGGAGGAGGAGGAAGAGGG - Intronic
1001309573 5:170601359-170601381 CAGGAGAAGGAGGCAGAAGCTGG + Intronic
1001313043 5:170624817-170624839 CAGGGTAAGGATGGTGAGGAAGG - Intronic
1001407657 5:171487247-171487269 AAGGGGAAGTTGGATCAAGAGGG + Intergenic
1001706044 5:173741758-173741780 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1001945655 5:175775392-175775414 GAGGGGAAGGAGAGTGAAGGAGG - Intergenic
1002067678 5:176660260-176660282 GAGTCGATGGAGGATGAAGATGG - Intergenic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002366486 5:178716595-178716617 CTGGGGAAGGAGGGGGATGAAGG + Intronic
1002380578 5:178825351-178825373 GATGAGATGGAGGATGAAGAAGG - Intergenic
1002525134 5:179811364-179811386 CAGGGGGAGGAGCATGCAGGGGG + Intronic
1002917170 6:1538658-1538680 GAGGGGAAGAAAGATGGAGAAGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1003620818 6:7697791-7697813 TGGGGGAAGGAGGGGGAAGAAGG + Intergenic
1003791672 6:9553264-9553286 CAGTGGAGAGGGGATGAAGATGG + Intergenic
1003817622 6:9859929-9859951 GAGGAGGAGGAGGATGAAGAAGG + Intronic
1003990705 6:11483575-11483597 CAGGAGGAGGGGGCTGAAGAAGG - Intergenic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1004477589 6:15988341-15988363 GAAGGGAGGGATGATGAAGAAGG + Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005026438 6:21466983-21467005 CAGTTGAAGGATGATGAAGGTGG - Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005407128 6:25501284-25501306 GAGGGGAAGGAAGATGGACATGG - Intronic
1005413249 6:25573141-25573163 CAAGGGGAGGAGGATGGGGAGGG + Intronic
1005594681 6:27368081-27368103 CATGGGAAGGAGGCTGGAGCCGG + Intergenic
1005622012 6:27628876-27628898 TGGGGGAAGGAGAAAGAAGAGGG + Intergenic
1005677019 6:28165092-28165114 AAGAGGGAGGATGATGAAGAGGG - Intergenic
1005896928 6:30186321-30186343 GAGGGGGATGAGGAGGAAGAGGG - Exonic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1005943061 6:30575536-30575558 CAGGGAAACAAGGATGGAGAGGG + Intronic
1006107634 6:31726140-31726162 CAAGGGTAGGAGGATGAGGTGGG - Intronic
1006193651 6:32224028-32224050 CAGGCCGAGGAGGAAGAAGAGGG - Exonic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006353118 6:33535821-33535843 TAAAGGAAGGAGGATGAAGGAGG + Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006512402 6:34528812-34528834 GAGACGAAGGAGGCTGAAGATGG + Exonic
1007028858 6:38607985-38608007 GAAGGGAAGGAAGAGGAAGAAGG - Intronic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007634121 6:43287723-43287745 CAGGGGGAGGAGGCTGCAGCTGG - Exonic
1007667915 6:43526840-43526862 CAGGTGAGGAAGGAGGAAGATGG + Intronic
1007692108 6:43709129-43709151 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1008042466 6:46816563-46816585 GAGGAGAAGGAGGAAGAAGAAGG + Intronic
1008421579 6:51306666-51306688 GAAGGGCAGGAGGAGGAAGAGGG - Intergenic
1008779781 6:55089650-55089672 AAGAGGATGGAGGAGGAAGAAGG - Intergenic
1008809103 6:55470821-55470843 CAGGAGAGAGAGCATGAAGAGGG + Intronic
1009058883 6:58373629-58373651 GAGGAGGAGGAAGATGAAGAGGG + Intergenic
1009231961 6:61073484-61073506 GAGGAGGAGGAAGATGAAGAGGG - Intergenic
1009567311 6:65325218-65325240 AAGGATGAGGAGGATGAAGAAGG - Intronic
1009593666 6:65708583-65708605 GAAGGGAAGGAGGAGGAGGAAGG - Intergenic
1010144583 6:72652456-72652478 AAGGGGAGGGAGGAAAAAGAGGG - Intronic
1010196878 6:73248426-73248448 GAGAGGAAGGAGGGGGAAGAAGG - Intronic
1010498328 6:76563602-76563624 AAGGGTAAGGAGGTAGAAGAAGG - Intergenic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1010738954 6:79476707-79476729 CAGAGAGAGGAGAATGAAGAAGG + Intergenic
1011175910 6:84559952-84559974 AAGGGGAAGGAAGTTGGAGAAGG - Intergenic
1011315838 6:86030185-86030207 CAAAGGAAGGAGGAAGAACAAGG - Intergenic
1011484746 6:87829964-87829986 AAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1011484783 6:87830104-87830126 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1011632353 6:89339579-89339601 GAGGGGAAGGGGGAAGGAGAGGG + Intronic
1011955279 6:93017719-93017741 GAAGGGAGGGAGGAAGAAGAAGG + Intergenic
1011999888 6:93641059-93641081 GAGGAAAAGGAGGAAGAAGAGGG + Intergenic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1013106439 6:107029913-107029935 CAGGGTAAGGGGGATTGAGAGGG - Intronic
1013926037 6:115473689-115473711 CAGGGGTGGGAGGAGGAGGAAGG + Intergenic
1014242439 6:119032616-119032638 GAGGGGGAGGAGGAGGAGGAAGG + Intronic
1014528050 6:122524131-122524153 GAGGGGGAGGAGGAGGAAGGAGG - Intronic
1014684378 6:124477732-124477754 AAGGGGAAGGGGGAAGGAGAGGG - Intronic
1014755994 6:125302181-125302203 CAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014856071 6:126402329-126402351 CAGGAGAAGAAAGATGGAGAGGG - Intergenic
1015471628 6:133612758-133612780 CAGAGAAAGGAGCATGGAGAGGG - Intergenic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1015659500 6:135559326-135559348 CAGGGGAAGGGGGAATAGGAAGG + Intergenic
1015679837 6:135793525-135793547 CAGGGGAAGGAGGCTGTCCAGGG + Intergenic
1015796029 6:137012248-137012270 CAGGGGCAGTAGGATAAATAAGG + Intronic
1015839581 6:137462265-137462287 CAGGAGACGGAGGTTGCAGAGGG + Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016806049 6:148213012-148213034 CAGGGGCAGGAGAATGTAAAAGG - Intergenic
1016833486 6:148455073-148455095 GAGGGAATGGAGAATGAAGATGG + Intronic
1017056516 6:150441492-150441514 TAGGAGAAGGTGGATGAGGAGGG - Intergenic
1017485765 6:154900714-154900736 CAAGGAAAGGAGGGGGAAGATGG + Intronic
1017491890 6:154952335-154952357 CAGGGGAAGAAGGATATGGAAGG - Intronic
1017870130 6:158479994-158480016 CAGGTGAGGGAGGAGGAAGAGGG - Intronic
1017896773 6:158686862-158686884 CAGGGCCAGGAGGAGGGAGAAGG - Intronic
1018038068 6:159898626-159898648 AAGAGGGAGGAGGAAGAAGAGGG - Intergenic
1018038088 6:159898694-159898716 AAGAGGGAGGAGGATGAAGGAGG - Intergenic
1018038092 6:159898710-159898732 AAGAGGGAGGAGGAGGAAGAGGG - Intergenic
1018108545 6:160512737-160512759 CAGGGAGAGGAGAATGAAAAGGG - Intergenic
1018683026 6:166280566-166280588 CAGGGAGAGGAGGATGAGGGTGG - Intergenic
1018719677 6:166563225-166563247 CTGGAGAAGGAAGATGGAGAAGG + Intronic
1018757564 6:166862982-166863004 CAGGAGAAGAGGGACGAAGAGGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018834618 6:167473589-167473611 GAGGGGAGGGAGGATGATGAGGG + Intergenic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1018887293 6:167950777-167950799 GAGGGTGAGGAGGATGAGGATGG + Intronic
1018961017 6:168448516-168448538 GATGGGGAGGAGGATGAGGATGG + Intronic
1018996595 6:168714983-168715005 GATGGGGAGGAGGAGGAAGACGG + Intergenic
1019159136 6:170057742-170057764 GAGGGGAGGGAGGAAGAAGAGGG - Intergenic
1019198044 6:170293640-170293662 CAGGAGGAGGAGGAAGGAGAGGG - Intergenic
1019320738 7:414283-414305 GAGGGGAAGGAGGAGAAGGAGGG - Intergenic
1019484076 7:1280485-1280507 AGGAGGAAGGAGGAAGAAGAAGG + Intergenic
1019484083 7:1280519-1280541 AGGAGGAAGGAGGAAGAAGAAGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019531786 7:1506854-1506876 GAGGGGGAGGAAGAGGAAGAGGG - Intergenic
1019761609 7:2816970-2816992 CAGGGGTAGGAGGTGGAAGTGGG - Intronic
1019880607 7:3857279-3857301 AAGGGGAAGGAGGAGGAGAAAGG + Intronic
1019882407 7:3874591-3874613 CAGGGGAACGGGGGTGGAGAAGG - Intronic
1019949924 7:4363126-4363148 CAGAGTAAGGAAGATGAGGAAGG - Intergenic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020208539 7:6139699-6139721 CAGGGCAGGGAGAATGCAGAGGG - Intronic
1020577385 7:9949965-9949987 GAGGGGGAGGGGGAGGAAGAGGG + Intergenic
1021055380 7:16041087-16041109 CAGGAGAAAGAGGGTGAAGGGGG - Intergenic
1021301635 7:18980697-18980719 AAGAGGAAGAAGGAAGAAGAAGG - Intronic
1021588542 7:22236555-22236577 CAGGGGAAGGAGGACCATGAAGG - Intronic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1021898469 7:25259618-25259640 AAGGGGAAGGAAGAAGTAGAGGG + Intergenic
1022037812 7:26550584-26550606 AAGAGGGAGGAGGAAGAAGAAGG + Intergenic
1022047140 7:26630890-26630912 CAGGGGAAGGAAGCTGAGGGAGG + Intergenic
1022306709 7:29153454-29153476 GAGGAGAAGAAGGAAGAAGAGGG - Intronic
1022494574 7:30844756-30844778 GAGGGGAAGGGTGCTGAAGAGGG + Intronic
1022593300 7:31687113-31687135 CAGGGCAAGGGGGATGGAGAAGG - Exonic
1022943258 7:35258700-35258722 GAGGGGAAGGAGGAGAAAGGAGG - Intergenic
1022972584 7:35531045-35531067 CAGGAGATGGGGGATCAAGAAGG + Intergenic
1022995989 7:35756154-35756176 CTGGGGAATGAGGGTGAAGGTGG - Intergenic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023214574 7:37847981-37848003 GAGGAGGAGGAGGAGGAAGAGGG + Intronic
1023281539 7:38575772-38575794 AAGTGGAAGGAGCATCAAGACGG - Intronic
1023295876 7:38714747-38714769 GAGGTGGAGGAGGAGGAAGAGGG - Intergenic
1023300010 7:38759946-38759968 AAGTGGAAGGAGGACCAAGATGG - Intronic
1023482598 7:40650206-40650228 CAGGGCAAGGAAGAGAAAGAGGG + Intronic
1023608830 7:41954407-41954429 GAGGGGAAGGGGGCTGGAGATGG + Intergenic
1023996409 7:45161630-45161652 GAGGGGGAGGAGGGTAAAGAAGG + Intronic
1024019547 7:45353358-45353380 CAGGGGAGGGAAGAGGAGGAAGG + Intergenic
1024051787 7:45628351-45628373 CATGGGCAGGAGCATGGAGATGG - Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024294293 7:47830395-47830417 GAGGGGAAGGGGGAGGAAAATGG + Intronic
1024516396 7:50262615-50262637 CAGTGGAAGGCAGAAGAAGAAGG - Intergenic
1024720960 7:52137107-52137129 GAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1024721007 7:52137379-52137401 AGGGGGGAGGAGGATGGAGAAGG + Intergenic
1024846254 7:53646170-53646192 GAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1025227875 7:57179782-57179804 CAGGGGAAGGAGCCTGCAGGGGG + Intergenic
1025228329 7:57182211-57182233 GAGGGGGAGGAGGAGGAGGAGGG - Intergenic
1026159053 7:67852801-67852823 CAGGAAAAGAAGGAAGAAGAGGG + Intergenic
1026191915 7:68136515-68136537 GAGGGGAAGGAGGAGGGAGGAGG + Intergenic
1026191923 7:68136534-68136556 GAGGGGAAGGAGGAGGGAGGAGG + Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1026679851 7:72457602-72457624 TGGGAGAAGGAGGAGGAAGAGGG - Intergenic
1026684923 7:72501457-72501479 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026994568 7:74606971-74606993 CAGGGGAAGGGGGTGGGAGAGGG - Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027572762 7:79891461-79891483 GAGGAGAAGGAGGAGGAAGGGGG + Intergenic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1027766136 7:82344627-82344649 CAGGGGGAGGATGATGGTGAAGG + Intronic
1027801032 7:82749367-82749389 GAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1028064196 7:86361081-86361103 CAAGGTAAAGAGGATAAAGATGG + Intergenic
1028164755 7:87525700-87525722 AAGGAAAAGGAGGAAGAAGAGGG + Intronic
1028268303 7:88756210-88756232 CAGGGGAAGGCAGAAGAAGGAGG + Intergenic
1028307627 7:89285911-89285933 GAGGAGAAGGAAGAAGAAGAGGG - Intronic
1028535459 7:91886850-91886872 CAGGGGGAGGGGGAGGGAGAGGG - Intergenic
1028705475 7:93839915-93839937 TTGGGGAAGGAGGATCATGAGGG + Intronic
1028765552 7:94554057-94554079 CAGCGGAAGGAGGATTTTGAAGG + Intronic
1028887716 7:95952780-95952802 CAGAGGAAGGACGAGGCAGAGGG - Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029090014 7:98040694-98040716 CAAGGAAAGGAGGATGATGGAGG + Intergenic
1029250603 7:99233489-99233511 CAGGGGAAGGAGGCTGATCTGGG - Intergenic
1029337735 7:99916657-99916679 CAGGGCAGGGATGATGGAGAGGG - Intronic
1029455417 7:100668438-100668460 AGGGGGAAGAAGGAAGAAGATGG + Intergenic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030138996 7:106285594-106285616 CAGGGTCAGGAGGATCAGGAGGG - Intronic
1030473911 7:110003582-110003604 GAAGGGAAGGAGGAGGATGAAGG + Intergenic
1030503272 7:110386548-110386570 CAGGGGAAATAGGATGGAGAGGG + Intergenic
1031083738 7:117282352-117282374 AAGGGGAGGGAGGAGAAAGAAGG + Intronic
1031597305 7:123662861-123662883 GAGGGGGAGGAGGAGGAGGAGGG - Exonic
1031630201 7:124034481-124034503 CGGGGGAAGGAGGAGAAAGAGGG - Intergenic
1031794156 7:126150112-126150134 TGGGGGAAGGAGGAGAAAGAGGG + Intergenic
1031854634 7:126907312-126907334 AAGAGGAAGGAGGGGGAAGAAGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031870086 7:127081619-127081641 AAGGGGAGGGAGGAGGCAGAGGG + Intronic
1031986127 7:128165955-128165977 CAGGGGCAGGGGCAGGAAGAGGG + Intergenic
1032122816 7:129169163-129169185 ACGGGGAATGAGGAGGAAGAAGG + Intronic
1032124932 7:129186886-129186908 CAGGAGCAGGAGGAAGAAGCGGG + Intergenic
1032182458 7:129692074-129692096 CAGGGGAATGTGGAGGGAGAGGG - Intronic
1032345306 7:131110714-131110736 TTGGGGAAGGAGGATGGTGAGGG - Intronic
1032466797 7:132151257-132151279 AAGGAGGAGGAGGAAGAAGAAGG + Intronic
1032466802 7:132151279-132151301 GAGGAGGAGGAGGAAGAAGAAGG + Intronic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032466810 7:132151314-132151336 GAGGAGGAGGAGGAAGAAGAAGG + Intronic
1032466815 7:132151336-132151358 GAGGAGGAGGAGGAAGAAGAAGG + Intronic
1032466842 7:132151434-132151456 GAGGAGGAGGAGGAAGAAGAAGG + Intronic
1032466852 7:132151475-132151497 GAGGAGGAGGAGGAAGAAGAAGG + Intronic
1032523110 7:132561274-132561296 AAGGAGGAGGAGGAGGAAGAGGG - Intronic
1032523852 7:132564393-132564415 GAGGGGGAGGAGCAAGAAGAGGG - Intronic
1032630421 7:133645010-133645032 CAGGTGAAGGAGGAGGAAAAGGG - Intronic
1032948708 7:136882402-136882424 GAGGAGAAGGAAGGTGAAGAGGG - Intronic
1033041713 7:137925197-137925219 GAGGGGAAGCAGGAGGCAGAGGG + Intronic
1033045967 7:137962444-137962466 AAGGGGAAGGAGGATGGTGCGGG - Intronic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033156924 7:138965070-138965092 CTGCTGAAGGAGGCTGAAGAGGG - Intronic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033263581 7:139865566-139865588 AGGGGGAGGGAGGAAGAAGAAGG + Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1033628068 7:143130472-143130494 CAGAGGAAGGCAGATGACGATGG - Intergenic
1033665147 7:143433980-143434002 CAGGGAAAGGTGGAGGAAAAAGG - Intergenic
1033832593 7:145271494-145271516 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1033832617 7:145271659-145271681 AAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1034210450 7:149358342-149358364 CACAGGAGGGAGGCTGAAGAGGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1034313129 7:150107689-150107711 CCGGGGAAGGAGGAGGTAGGGGG + Intergenic
1034420983 7:150990572-150990594 CAGAGGAGGGAAGAAGAAGAAGG + Intergenic
1034440299 7:151082691-151082713 GAGGGGACGGAGGCTGAGGACGG - Intronic
1034720777 7:153290188-153290210 GAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1034793733 7:153992978-153993000 CCGGGGAAGGAGGAGGTAGGGGG - Intronic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035419718 7:158717432-158717454 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419745 7:158717571-158717593 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035454198 7:158998094-158998116 GAGGGGAGCGTGGATGAAGATGG - Intergenic
1035454232 7:158998196-158998218 GAGGGGAGCGTGGATGAAGATGG - Intergenic
1035454407 7:158998708-158998730 GAGGGGAGCGTGGATGAAGATGG - Intergenic
1035479067 7:159167560-159167582 CAGGGGAAGGAGGGAGAGGGTGG - Intergenic
1035524463 8:301341-301363 CTGGGGAAGGAAGAGCAAGAAGG + Intergenic
1035622371 8:1043614-1043636 GTGGGGAAGGGGGATGAAGGGGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036188690 8:6649337-6649359 CAGGTGACTGAGGATGAATAAGG + Intergenic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1036776591 8:11617206-11617228 CAGGAGAATGGAGATGAAGACGG + Intergenic
1036796051 8:11757568-11757590 GTGGGGAAGGAGGAGGAAGCTGG + Intronic
1037041686 8:14244214-14244236 GAAGAGAAGGAGGAGGAAGAAGG - Intronic
1037041690 8:14244236-14244258 GAAGAGAAGGAGGAGGAAGAAGG - Intronic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037568851 8:20141600-20141622 GAGGAGGAGGAGGAAGAAGAGGG + Intergenic
1037683694 8:21119621-21119643 CTGTGGAAGGAGGATGAAGTTGG + Intergenic
1037760401 8:21738141-21738163 GAGGGGGAGGGGGATGAGGAGGG - Intronic
1037800788 8:22034129-22034151 GAGGAGGAGGAGGAAGAAGAAGG + Exonic
1037839292 8:22232435-22232457 AAGGGGAGGGAGGCTGTAGAGGG + Intergenic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1038147571 8:24913145-24913167 AAGGGGAAGGAGGGAGGAGACGG + Exonic
1038284969 8:26198503-26198525 GAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038540884 8:28389314-28389336 TAGGGGAAGGGGGAAGAAGAGGG - Intronic
1038664555 8:29526900-29526922 CAGGTGAAGAGGGAGGAAGAGGG - Intergenic
1038701732 8:29855489-29855511 GAGGGCAAGGAGGATGAGAAAGG - Intergenic
1038795238 8:30703782-30703804 CAGGGGAAGGAAGAAGGAGGAGG + Intronic
1038913304 8:31991757-31991779 TTGGGGAAGGAGGAGGGAGAAGG - Intronic
1038980465 8:32753887-32753909 CAGGGGCTGGGGGATAAAGAGGG + Intronic
1039156301 8:34562346-34562368 AAGAGGAAGGAAGAGGAAGAAGG + Intergenic
1039317344 8:36387998-36388020 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1039529901 8:38251414-38251436 CAAGGGAAGTAGGATGTCGATGG - Intronic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039691291 8:39867636-39867658 GAGGGGGAGGAGGAGGAAGGCGG - Intergenic
1039788938 8:40858786-40858808 CAGGGGCAGGAAGATGAGCACGG - Intronic
1040072226 8:43197875-43197897 CAGGACCAGCAGGATGAAGAAGG - Exonic
1040387157 8:46921322-46921344 CAGGGGAAGGAGGAACAGGCTGG + Intergenic
1041252256 8:55945936-55945958 CAGCGGCAGCAGGATGGAGACGG - Intronic
1041362141 8:57065716-57065738 CAGGAGAAGGAGGAAGCAGTGGG - Intergenic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1041698566 8:60763002-60763024 CAGGGGGAGGTGGGAGAAGATGG + Intronic
1041910892 8:63087015-63087037 CTGGGGAATGAAGATGAAGTAGG + Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042403584 8:68377449-68377471 GAGGGGGAGGAGGAAGAAAAGGG + Intronic
1042610407 8:70593526-70593548 CAGGTGAAGGAAAGTGAAGAGGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042872746 8:73413029-73413051 CAGGGGAAGCTGGGAGAAGAAGG - Intergenic
1043099382 8:76021300-76021322 CAGGAGGAAGAGGAAGAAGAGGG - Intergenic
1043256297 8:78141913-78141935 AAGGAGAAAGAGGAAGAAGATGG - Intergenic
1043386432 8:79752561-79752583 GAGGAAAAGGAGGAGGAAGAAGG + Intergenic
1043750355 8:83926616-83926638 CATGGGAGGGAGGCTGAAGGGGG - Intergenic
1044011754 8:87002712-87002734 AAGGGTAAGAGGGATGAAGAAGG - Intronic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045420264 8:102007733-102007755 CAGAGGGAGGAGGAAGTAGAAGG - Intronic
1045474642 8:102542575-102542597 TAGGGGGAGGAGGAGGGAGAGGG - Intergenic
1045543688 8:103109546-103109568 CTGGGAAGGAAGGATGAAGAAGG + Intergenic
1045769790 8:105722703-105722725 GAGGAGAAGGAGGAAGATGAGGG + Intronic
1045881516 8:107045942-107045964 TGGGGGAGGGAGGATGGAGAGGG + Intergenic
1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG + Intergenic
1046214491 8:111126181-111126203 CAGGGGATGGAGGTTGCAGTGGG - Intergenic
1046574889 8:116015309-116015331 GAGCAGAAGGAGGAAGAAGAGGG - Intergenic
1046669816 8:117045053-117045075 CAAAAGAAGGAGGATGCAGAAGG - Intronic
1046674710 8:117094839-117094861 CATGGGAAGGAGGCTGAGGTGGG - Intronic
1047018235 8:120746172-120746194 GAGGAGGAGGAGGAAGAAGAGGG - Intronic
1047371122 8:124256937-124256959 AAGGGGAAGGAGGATGAGTCTGG - Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047811930 8:128420063-128420085 CAGGGAAAGGAGGAAGAAAGAGG - Intergenic
1047866478 8:129029492-129029514 ACGGGGAAGAAGGAGGAAGAAGG - Intergenic
1047884239 8:129230938-129230960 CAGGGGAAGAGGCATGTAGATGG + Intergenic
1047996551 8:130342178-130342200 GGGGGTGAGGAGGATGAAGAAGG + Intronic
1048056361 8:130869969-130869991 GAGGAGGAGGAGGAGGAAGAAGG - Intronic
1048201441 8:132377496-132377518 AAGGGGCAGGAGGATGAGGCTGG + Intronic
1048290488 8:133177697-133177719 GAGGAGAGGGAGGATGAAGAAGG - Intergenic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1048417598 8:134243795-134243817 GAGGAGAAGGAGGAGGAAGGAGG + Intergenic
1048477162 8:134754097-134754119 CTGGGGAAGCAGGGTGAAAAAGG + Intergenic
1048977552 8:139681457-139681479 CAGGGGAAGGAGTGAGAAGCTGG + Intronic
1049037230 8:140086230-140086252 CAGAGTATGGAGGATGAAGAAGG + Intronic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049140337 8:140949023-140949045 GAGGAGGAGGAGGAAGAAGAGGG - Intronic
1049145721 8:141000498-141000520 GAGAGGCAGGAGGAGGAAGAGGG - Intronic
1049261328 8:141640748-141640770 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049386076 8:142343793-142343815 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1049528613 8:143142412-143142434 CTGGGGAAGGAGGAGGGACAGGG - Intergenic
1049543017 8:143216981-143217003 CAGCAGAAGGAGGAAGGAGAAGG - Intergenic
1049544246 8:143222002-143222024 CAGGGGACAGAGGCTGAAGGGGG - Intergenic
1049658340 8:143808724-143808746 GAGGAGGAGGAGGAGGAAGAGGG - Exonic
1049797897 8:144504888-144504910 CAGGGCCAGGAGGAAGCAGAGGG + Intronic
1049813571 8:144587404-144587426 CAGAGGAAGGAAAATGTAGAGGG + Intronic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1051283870 9:15474157-15474179 CAGCCTAAGAAGGATGAAGAGGG - Exonic
1051918510 9:22235973-22235995 CTGGGTAAGGAGGCTGTAGATGG + Intergenic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052255641 9:26453223-26453245 GAGGGGAAGAAGGAAAAAGAAGG + Intergenic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052918163 9:33939854-33939876 GAGGGGGAGGAGGAGGAGGAGGG + Intronic
1053221410 9:36316131-36316153 GAGGAGAAGGAGGGGGAAGAGGG + Intergenic
1053463083 9:38285576-38285598 CAAGGTGAGGAGAATGAAGAAGG - Intergenic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053575555 9:39355555-39355577 GAGGGGGAGGAGGAGGGAGAGGG - Intergenic
1053619190 9:39798736-39798758 CATGGGAAGGAGGCTGAAGTGGG - Intergenic
1053877347 9:42558085-42558107 CATGGGGAGGAGGCTGAAGTGGG - Intergenic
1053895316 9:42736603-42736625 CATGGGAAGGAGGCTGAAGTGGG + Intergenic
1054234346 9:62543637-62543659 CATGGGGAGGAGGCTGAAGTGGG + Intergenic
1054264967 9:62908693-62908715 CATGGGAAGGAGGCTGAAGTGGG + Intergenic
1055000990 9:71448171-71448193 AAGGTGAAGAAGGATTAAGAGGG + Intergenic
1055098561 9:72439818-72439840 CAGGGGAAGAAGGAATAATAAGG - Intergenic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1056233475 9:84569788-84569810 CAGGGGGAGGAAAAAGAAGATGG + Intergenic
1056283071 9:85061463-85061485 CAGTGGGAGGAGGATGCATATGG + Intergenic
1056513363 9:87327130-87327152 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056814617 9:89792264-89792286 CAGGGGTAGGAGGATTTGGATGG + Intergenic
1056896612 9:90556712-90556734 CAGTGGATGGTGGGTGAAGATGG - Intergenic
1056928496 9:90854792-90854814 CAGGGGAAGGAAGGTCAGGAGGG - Intronic
1057020973 9:91697467-91697489 CTGGGGAAGGTGGGTGGAGAGGG + Intronic
1057120080 9:92563781-92563803 GAGGAGGAGGAGGAGGAAGAGGG - Intronic
1057480343 9:95440481-95440503 GAGGGGAAGGAGGGAGAAGGGGG + Intergenic
1057532996 9:95870906-95870928 GAAAAGAAGGAGGATGAAGAGGG - Intergenic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058405987 9:104674642-104674664 CATGGGAAGGAGGTAGGAGATGG - Intergenic
1058561481 9:106233369-106233391 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1058563025 9:106249755-106249777 CAGCAGAAGAAGGAAGAAGACGG - Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058656713 9:107228928-107228950 CGGGGGATGGGGGAGGAAGAGGG + Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058781087 9:108336209-108336231 CAGGGGAAGCAGGACTAAAAGGG - Intergenic
1059072479 9:111153014-111153036 AGGAGGAAGGAGGAGGAAGAAGG + Intergenic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059183242 9:112240071-112240093 GAGGGGTAGAAGGATGAAGTAGG + Intronic
1059350634 9:113662454-113662476 CAGGAGAAGGAGGCAGGAGAAGG - Intergenic
1059437022 9:114283068-114283090 CCAGGGAAGGAGGCTGAAGAGGG + Intronic
1059449199 9:114359714-114359736 GAGGAGGAGGAGGAGGAAGAGGG - Exonic
1059456619 9:114403867-114403889 CAGGAGGAGGAGGATGCAGAGGG - Intronic
1059469768 9:114495871-114495893 CAGGGACAGGAGGATGGACATGG + Intronic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059751932 9:117255778-117255800 CAGGGAGGGGAGGAGGAAGAAGG + Intronic
1059897259 9:118880510-118880532 GAAGGAAAGGAGGAAGAAGAGGG - Intergenic
1060055916 9:120412898-120412920 CAGGGGAGAGTGGAGGAAGATGG - Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062050502 9:134444396-134444418 GAGGGGAAGGAGGAGGGAGGGGG - Intergenic
1062086604 9:134652439-134652461 CAGGGGCAGGAGGATGACACTGG - Intronic
1062163925 9:135096201-135096223 GAGGAAGAGGAGGATGAAGAGGG - Intronic
1062254244 9:135613643-135613665 CAGGGGCAGGAGGATGGGGCAGG + Intergenic
1062362634 9:136194822-136194844 GAGGGGAGGGAAGATGGAGAAGG - Intergenic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1062584794 9:137244411-137244433 CGGGGGTAGGGGGATGCAGAAGG - Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638398 9:137503540-137503562 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638407 9:137503575-137503597 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638411 9:137503594-137503616 AAGGAGAAGGAGGAAGAAGGAGG + Intronic
1062638424 9:137503636-137503658 AAGGAGAAGGGGGAGGAAGAAGG + Intronic
1062638430 9:137503661-137503683 AAGGGGAAGGAAGAAGGAGAAGG + Intronic
1062685305 9:137809590-137809612 GAGGGGAAGGAGGCTGCAGCCGG + Intronic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185617695 X:1433301-1433323 CAGGGGGAGGGGGCTGGAGATGG + Intronic
1185637709 X:1565671-1565693 CAGGAGAAGGAGGTTGCAGTGGG - Intergenic
1185640553 X:1587925-1587947 CAGGGGAAGGGGGGAGGAGAGGG - Intergenic
1185814488 X:3142384-3142406 GAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1185915993 X:4036157-4036179 GAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186245618 X:7613454-7613476 CAGGGGCTGGAGGTGGAAGAAGG - Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1186311340 X:8322974-8322996 GAGGAGGAGGAGGAAGAAGAGGG + Intergenic
1186361441 X:8846105-8846127 AAGGAGAAGGAAGAGGAAGAAGG - Intergenic
1186402601 X:9273619-9273641 AGGAGGAAGGAGGAAGAAGAAGG + Intergenic
1186402607 X:9273647-9273669 AGGAGGAAGGAGGAAGAAGAAGG + Intergenic
1186579195 X:10799132-10799154 CAGGTGAGGGGGGATGAAAAAGG - Intronic
1186595126 X:10972891-10972913 CTAGGGAAGGGAGATGAAGAGGG - Intergenic
1186701583 X:12095897-12095919 CACAGGAAGCAGGATGGAGAGGG - Intergenic
1187289880 X:17942698-17942720 GAGGTGGAGGAGGAGGAAGAGGG + Intergenic
1187447668 X:19373130-19373152 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1188038132 X:25341188-25341210 CAGGAAAAGGAAGAAGAAGAGGG - Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188146674 X:26622263-26622285 TAAGGGAAGGAGGAAGAGGAGGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188344375 X:29045914-29045936 GAGGAGGAGGAGGAGGAAGAAGG - Intronic
1188344381 X:29045936-29045958 GAGGAGGAGGAGGAGGAAGAAGG - Intronic
1188344391 X:29045976-29045998 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
1189323122 X:40098002-40098024 GAGGGGGAGGAGGAAGAGGAGGG - Intronic
1189377139 X:40474886-40474908 CAGGGGCAGGAAGAGGGAGAAGG + Intergenic
1189558572 X:42169819-42169841 GAGGAGGAGGAGGAAGAAGAGGG + Intergenic
1189578194 X:42377657-42377679 CAAGGGAAGCAGAATGAAAAAGG - Intergenic
1189891797 X:45610565-45610587 CAGGGGAAGGAGGGTGTGGGTGG + Intergenic
1190236072 X:48616758-48616780 AAAGGGAAGGAGGAGGAAGCAGG + Intergenic
1190726191 X:53192501-53192523 CAGGGGAAGGGAGAGGGAGAAGG + Exonic
1190939565 X:55027413-55027435 CAGGGGGATGAGGGTTAAGAGGG + Intronic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1191791634 X:64977570-64977592 CAGGAGAAGGAGGTTGCAGTGGG - Intronic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192091225 X:68158651-68158673 CAGGGGAAGGGGGAGGGAGCAGG - Intronic
1192134655 X:68585899-68585921 CATGGGGAGCAGGAAGAAGACGG + Intergenic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192435610 X:71141817-71141839 TTGGGAAAGGAGGTTGAAGAAGG + Intronic
1192448957 X:71230897-71230919 AAGGGGAAGGGGAAGGAAGAGGG + Intergenic
1192503002 X:71665503-71665525 GAGGAGGAGGAGGATGAAGAGGG + Intergenic
1192576255 X:72245600-72245622 CAGGGGAAGCAGGAAGGAGGAGG + Intronic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193032621 X:76915708-76915730 GAGGGGAAGGTGGATGAATGGGG + Intergenic
1193620678 X:83749941-83749963 CAGGAGGAGGAGGAGGACGAGGG - Intergenic
1194049027 X:89045301-89045323 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1194329266 X:92560707-92560729 AAGGGGATGGAAGATGTAGAAGG + Intronic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195273281 X:103254212-103254234 CAGGAGCAGGAGGAGAAAGATGG - Intronic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195517526 X:105794390-105794412 GAGGGGGAGGAGGAAGAGGAGGG + Intergenic
1195577546 X:106468126-106468148 GAGGGGGAGGAAGAAGAAGAAGG - Intergenic
1195577552 X:106468150-106468172 GAGGGGGAGGAAGAAGAAGAAGG - Intergenic
1195577556 X:106468168-106468190 GAGGAGGAGGAGGGTGAAGAGGG - Intergenic
1195769884 X:108339364-108339386 AAAGGAAAGGAGGATGAAAAGGG - Intronic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196477755 X:116108601-116108623 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1196554325 X:117069748-117069770 CGGGGGAAGGGGGAGGAAGCTGG + Intergenic
1196558154 X:117115959-117115981 CAGGGGATGGAGAAAGCAGAAGG - Intergenic
1196899204 X:120366657-120366679 GAGGAAAAGGAGGAGGAAGAGGG + Exonic
1197641201 X:128970226-128970248 GAGAGGCAAGAGGATGAAGAGGG - Intergenic
1197719988 X:129738658-129738680 GAGGGGAAGGAGGAAAAAGGAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198163054 X:134026373-134026395 GAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1198410577 X:136363022-136363044 CAGGGGAGGGTGGATGATGAGGG + Intronic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199751573 X:150824242-150824264 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1199871796 X:151904828-151904850 TTGGGGAAAGAGGATGGAGAAGG + Intergenic
1200058694 X:153474584-153474606 CCGGGGCAGGAGGACAAAGATGG - Intronic
1200216837 X:154371784-154371806 CCGGGGAAGGGGGATGACGGCGG - Intronic
1200586083 Y:5005805-5005827 AAGGGGGAGGAGGATGTAAAAGG - Intronic
1200637965 Y:5679896-5679918 AAGGGGATGGAAGATGTAGAAGG + Intronic
1200801613 Y:7392399-7392421 AAGGAGAAGGAGGAAGAAAAAGG - Intergenic
1200951383 Y:8902818-8902840 CAGGGGATGGAGGACAATGAGGG - Intergenic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201248441 Y:12030545-12030567 CAGGGTGAGGAGGTTGAAAAGGG + Intergenic
1201341804 Y:12942323-12942345 AAGGGGAAGGGGCAAGAAGAAGG + Intergenic
1201422824 Y:13818956-13818978 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1201739754 Y:17311286-17311308 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic