ID: 988690247

View in Genome Browser
Species Human (GRCh38)
Location 5:33564660-33564682
Sequence TCTCATCTATTGGGCACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988690242_988690247 -9 Left 988690242 5:33564646-33564668 CCCAGGTCCTTCACTCTCATCTA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 988690247 5:33564660-33564682 TCTCATCTATTGGGCACCATTGG 0: 1
1: 0
2: 0
3: 7
4: 76
988690243_988690247 -10 Left 988690243 5:33564647-33564669 CCAGGTCCTTCACTCTCATCTAT No data
Right 988690247 5:33564660-33564682 TCTCATCTATTGGGCACCATTGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988690247 Original CRISPR TCTCATCTATTGGGCACCAT TGG Intronic