ID: 988691594

View in Genome Browser
Species Human (GRCh38)
Location 5:33577872-33577894
Sequence CATGGCATACAGAATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 282}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988691594_988691600 7 Left 988691594 5:33577872-33577894 CCCTCCACATTCTGTATGCCATG 0: 1
1: 0
2: 0
3: 34
4: 282
Right 988691600 5:33577902-33577924 CCAAGCAGCTAGACTGCCTTTGG 0: 1
1: 0
2: 1
3: 6
4: 142
988691594_988691603 10 Left 988691594 5:33577872-33577894 CCCTCCACATTCTGTATGCCATG 0: 1
1: 0
2: 0
3: 34
4: 282
Right 988691603 5:33577905-33577927 AGCAGCTAGACTGCCTTTGGGGG 0: 1
1: 0
2: 2
3: 15
4: 159
988691594_988691602 9 Left 988691594 5:33577872-33577894 CCCTCCACATTCTGTATGCCATG 0: 1
1: 0
2: 0
3: 34
4: 282
Right 988691602 5:33577904-33577926 AAGCAGCTAGACTGCCTTTGGGG No data
988691594_988691605 27 Left 988691594 5:33577872-33577894 CCCTCCACATTCTGTATGCCATG 0: 1
1: 0
2: 0
3: 34
4: 282
Right 988691605 5:33577922-33577944 TGGGGGAATCCTAACAGAACAGG No data
988691594_988691601 8 Left 988691594 5:33577872-33577894 CCCTCCACATTCTGTATGCCATG 0: 1
1: 0
2: 0
3: 34
4: 282
Right 988691601 5:33577903-33577925 CAAGCAGCTAGACTGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988691594 Original CRISPR CATGGCATACAGAATGTGGA GGG (reversed) Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902063457 1:13664737-13664759 CATGCCCTACAGAAATTGGAGGG - Intergenic
902747157 1:18481798-18481820 CATTTCATACAGAAGGCGGAGGG + Exonic
903435055 1:23343641-23343663 CGCGGCATGCAGAATGTGGGAGG + Intronic
903943892 1:26950006-26950028 CATGGCCTACAGAATGAAGAGGG - Exonic
904811228 1:33164651-33164673 CATGGGATACAGACTCTGAAAGG - Intronic
904867107 1:33588716-33588738 CATGGCGCACTGGATGTGGATGG - Intronic
905100703 1:35519594-35519616 CATGCCACACAGAATTTTGAAGG - Intronic
905975420 1:42170755-42170777 AATGTCACACAGAAAGTGGATGG + Intergenic
907998664 1:59658545-59658567 CATAGGATACAGAGTGAGGAGGG + Intronic
909412904 1:75375033-75375055 CATAGAATTCAGAATATGGATGG + Intronic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
910610404 1:89134867-89134889 TATGGAATTCAGAATCTGGATGG + Intronic
911054167 1:93696576-93696598 CATGGAAGACAGAATGGAGAAGG - Intronic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
913552989 1:119935218-119935240 CATGAAACACAGAATATGGAAGG - Intronic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
917011627 1:170481016-170481038 CATAGAATTCAGAATCTGGATGG - Intergenic
918047841 1:180952165-180952187 CATGGCTCACAGAATGGGGTAGG + Intergenic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
918552594 1:185760628-185760650 TAGGGCATACAGTGTGTGGAAGG + Intronic
919555505 1:199047155-199047177 CATAGAATTCAGAATCTGGATGG + Intergenic
919712906 1:200746275-200746297 GATGGCATCTTGAATGTGGATGG + Intronic
920973111 1:210759342-210759364 CATAGAATTCAGAATATGGATGG + Intronic
921094263 1:211873674-211873696 CAAGGCTTCCACAATGTGGAAGG + Intergenic
923655261 1:235910424-235910446 CAGGGGCCACAGAATGTGGATGG - Intergenic
1064411025 10:15104183-15104205 CATGTCATACAGTTTGTGAAAGG + Exonic
1066153441 10:32649980-32650002 CATGGAATTCAGAATCTTGACGG - Intronic
1068055387 10:52006302-52006324 AATAGAATACAGAATATGGATGG + Intronic
1068353609 10:55881690-55881712 CATAGAATTCAGAATCTGGATGG + Intergenic
1068396369 10:56466687-56466709 CATAGAATTCAGAATCTGGATGG + Intergenic
1069336675 10:67359410-67359432 CATAGAATTCAGAATCTGGATGG + Intronic
1069356881 10:67597234-67597256 CATAGAATTCAGAATTTGGATGG - Intronic
1069683225 10:70300023-70300045 CACGGCACACAGGATTTGGACGG + Exonic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1071230280 10:83578738-83578760 CATAGAATTCAGAATCTGGATGG - Intergenic
1071347678 10:84707934-84707956 CTTGTCATAGAGACTGTGGAGGG - Intergenic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1072743289 10:97923078-97923100 CATGGGAGACAGGATGTGAAAGG + Intronic
1073775829 10:106784999-106785021 CAAGGGATGAAGAATGTGGATGG - Intronic
1074759259 10:116654160-116654182 CATAGAATTCAGAATCTGGATGG - Intergenic
1075467735 10:122664181-122664203 CATCCCACAAAGAATGTGGATGG - Intergenic
1075655276 10:124156942-124156964 CCGGGCACACAGAATGGGGAAGG + Intergenic
1076070000 10:127481828-127481850 CATGGGGTACAGAGAGTGGAAGG - Intergenic
1076749296 10:132534334-132534356 CCTGACATATAGACTGTGGAAGG + Intergenic
1077169670 11:1160595-1160617 CATGGCCTGCAGAAAGAGGAGGG - Exonic
1079735806 11:23995205-23995227 CATAGAATTCAGAATCTGGATGG + Intergenic
1079754051 11:24234103-24234125 CATGTAATTCAGAATCTGGATGG - Intergenic
1080876164 11:36276228-36276250 CGTGGCAGAGAGACTGTGGAAGG + Exonic
1083297715 11:61724208-61724230 CATGGCAGACAAAATGAGGGAGG + Intronic
1085220201 11:74867248-74867270 AATGGAATTCAGAATATGGATGG + Intronic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1086229606 11:84552431-84552453 CATGGCAAAAGGCATGTGGAAGG - Intronic
1087791823 11:102413884-102413906 CATGGAATTAAGAATCTGGAGGG + Intronic
1087971144 11:104485881-104485903 CATGGTATTCAGATTCTGGAAGG + Intergenic
1088507886 11:110543468-110543490 CATCGAATTCAGAATTTGGATGG + Intergenic
1088744389 11:112793383-112793405 CATTACAGACAGAATGAGGATGG + Intergenic
1090142398 11:124278332-124278354 CATGGAATTCAGAATCTGGATGG + Intergenic
1092637592 12:10468556-10468578 CATAGAATTCAGAATCTGGATGG - Intergenic
1092831268 12:12446839-12446861 AAAGGCATAATGAATGTGGAAGG + Intronic
1092951460 12:13507450-13507472 CTTGGCACACAGGATGGGGAGGG + Intergenic
1093800765 12:23369542-23369564 CATGTCAAAAAGGATGTGGAGGG + Intergenic
1095259406 12:40081653-40081675 CATAGAATACAGAATTTGCATGG - Intronic
1095473998 12:42566403-42566425 GATGGCAAACAGAAATTGGAGGG + Intronic
1096048845 12:48587853-48587875 CATAGAATTCAGAATCTGGATGG + Intergenic
1099353942 12:81610696-81610718 CATAGAATTCAGAATCTGGACGG - Intronic
1101275560 12:103197533-103197555 CATAGCATTCAGAATCTGGATGG - Intergenic
1102531663 12:113551194-113551216 TTTGGCCAACAGAATGTGGAGGG - Intergenic
1107023962 13:35780704-35780726 CAGGGCTTACAGATTGTGGTAGG - Intronic
1108437849 13:50418100-50418122 CTTGGCATACAGAATATTCATGG + Intronic
1110186580 13:72682040-72682062 CACAGCATAAAGAATGAGGAAGG + Intergenic
1110966977 13:81712602-81712624 CATGGAATTCAGAGTCTGGATGG - Intergenic
1111040311 13:82739749-82739771 CATAGAATTCAGAATCTGGACGG - Intergenic
1111407804 13:87832645-87832667 CATGGCTTACAGCATGAGAAGGG - Intergenic
1113146020 13:107208434-107208456 CCTGGCATTCTGAATGTGTATGG + Intronic
1114938440 14:27574126-27574148 CATGGAATTCAGAATCTGGATGG + Intergenic
1116734576 14:48672040-48672062 CATAGAATTCAGAATCTGGATGG + Intergenic
1116939517 14:50776953-50776975 TATGGTTTACAGAATGTGGATGG - Exonic
1118068829 14:62223176-62223198 CATAGAATTCAGAATCTGGATGG - Intergenic
1121703048 14:95970642-95970664 CAAGGCAAACAGAATGGAGAAGG + Intergenic
1123507122 15:20954250-20954272 GATGGAATACAGAATGTGAAGGG - Intergenic
1123564349 15:21527997-21528019 GATGGAATACAGAATGTGAAGGG - Intergenic
1123600602 15:21965280-21965302 GATGGAATACAGAATGTGAAGGG - Intergenic
1125376744 15:39038266-39038288 CATGGCATACTGAATGAGCAGGG - Intergenic
1125435525 15:39640748-39640770 AATGACATACAGAAATTGGAAGG + Intronic
1126869200 15:52969595-52969617 CATGCACTAAAGAATGTGGATGG + Intergenic
1127097339 15:55526312-55526334 CATAGAATTCAGAATCTGGATGG - Intergenic
1127097512 15:55527397-55527419 AATGGCAGACAGCCTGTGGATGG + Intergenic
1128028254 15:64457873-64457895 CAAGGCATCCAGCATGTGGAGGG + Intergenic
1129377423 15:75142755-75142777 CATGGCATAGAGAAGGTATAGGG - Intergenic
1131407219 15:92175343-92175365 CATGGGATGCAGGAAGTGGAGGG - Intergenic
1131558004 15:93415833-93415855 CTTGGCATCCAGGCTGTGGAAGG + Intergenic
1202972710 15_KI270727v1_random:255101-255123 GATGGAATACAGAATGTGAAGGG - Intergenic
1137323751 16:47412283-47412305 CATAGAATTCAGAATCTGGATGG + Intronic
1139691050 16:68642397-68642419 CTTGCCATCCAGAGTGTGGAGGG - Intronic
1140577423 16:76187191-76187213 CATGGAATCCAGCATCTGGATGG + Intergenic
1141424731 16:83937445-83937467 CATAGTCTACAGAATGTGGGAGG - Intronic
1142038254 16:87875934-87875956 AATGGCATAGAGAGTGTGAAAGG - Intergenic
1144477007 17:15597019-15597041 CATGGCATACAGCTTGAGTAGGG + Intronic
1144921233 17:18766335-18766357 CATGGCATACAGCTTGAGTAGGG - Intronic
1145872244 17:28284466-28284488 CATGCCACACTGAATGTGGAAGG - Intergenic
1147569980 17:41564020-41564042 CATGGAACAAGGAATGTGGATGG - Intergenic
1148008324 17:44453227-44453249 CATGCCACACTGAATGTGGAAGG - Intronic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1149078876 17:52630372-52630394 CATAGAATTCAGAATCTGGATGG + Intergenic
1154343853 18:13526309-13526331 CATGTCATAAAGTGTGTGGAAGG + Intronic
1158755522 18:60320170-60320192 CATAGAATTCAGAATCTGGATGG - Intergenic
1160051105 18:75434380-75434402 CATGGCAGCTAGAAAGTGGAGGG + Intergenic
1161688008 19:5713126-5713148 CATGGGACACAGAAGGTGGGTGG - Exonic
1164460355 19:28442288-28442310 CATGCATTACAGAATGTGAAAGG - Intergenic
1164771138 19:30810011-30810033 CATAGAATTCAGAATCTGGAAGG + Intergenic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167714783 19:51136042-51136064 CATAGAATTCAGAATCTGGATGG - Exonic
1167781221 19:51600696-51600718 CTTGGTATACAGTAGGTGGATGG + Intergenic
1168441326 19:56369771-56369793 CATAACAAACAGAATGTGTAGGG - Intergenic
925191451 2:1887650-1887672 CATGGCACACAGACTGAGGGAGG + Intronic
925827254 2:7861632-7861654 AATGGCCTACAGAAGCTGGAAGG - Intergenic
926496194 2:13592038-13592060 CATAGAATTCAGAATCTGGATGG - Intergenic
926627300 2:15102934-15102956 CAGGGTATACAGATTTTGGAGGG + Intergenic
926893448 2:17658849-17658871 CATTGCATATTGCATGTGGAAGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
929864911 2:45709570-45709592 CTTGGAATCCAGAATGGGGATGG - Intronic
930152138 2:48069910-48069932 GAAGGCATCCAGAATGAGGAAGG + Intergenic
932105962 2:68943361-68943383 CATGGAATTCAGAATCTGAATGG - Intergenic
932977655 2:76624132-76624154 CATGGAATTTAGAATCTGGATGG - Intergenic
936075167 2:109397133-109397155 CCTGGCAGACAGAATGTGCCAGG + Intronic
937065010 2:119011348-119011370 CATGGCACACAGAAGGTGCTTGG + Intergenic
937803308 2:126106074-126106096 CATTGCAAAAAGAATGTGGTAGG + Intergenic
938282479 2:130074426-130074448 CATGGCCCACAGAATGCAGAAGG - Exonic
938333108 2:130462998-130463020 CATGGCCCACAGAATGCAGAAGG - Exonic
938356703 2:130657673-130657695 CATGGCCCACAGAATGCAGAAGG + Exonic
938433139 2:131264479-131264501 CATGGCCCACAGAATGCAGAAGG + Exonic
939692690 2:145285248-145285270 CATGGCATATATAAAGTGTATGG - Intergenic
939757242 2:146129924-146129946 CATAGAATTCAGAATCTGGATGG - Intergenic
940270076 2:151880936-151880958 CATGGAATAAGGAATGAGGAAGG + Intronic
941681109 2:168400760-168400782 CATAGAATTCAGAATCTGGATGG - Intergenic
942643403 2:178085074-178085096 CATGGCATATAGACTGTGGTTGG - Intronic
942908304 2:181209302-181209324 CATAGAATTCAGAATCTGGATGG + Intergenic
944953212 2:204776885-204776907 GATGGCATACATAATGGGGGTGG + Intronic
945444471 2:209919856-209919878 CTTGGGATACAGATTGTGGCTGG - Intronic
945758800 2:213884953-213884975 CAAGGAATTCAGAATCTGGATGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
1169458149 20:5770872-5770894 CATGGCAAACAGATTCAGGATGG + Intronic
1170814456 20:19701143-19701165 CATGGCACACAGTATGGGGCAGG + Intronic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1172151800 20:32796106-32796128 CATGGAATACAGAATGTGTGAGG + Intronic
1173225530 20:41160355-41160377 CAGGGCACACAGCATGTGGCTGG - Intronic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1177538297 21:22458453-22458475 TGTGGAATAAAGAATGTGGAAGG + Intergenic
1178436723 21:32566678-32566700 CATAGAATTCAGAATCTGGATGG - Intergenic
1178596409 21:33957421-33957443 CATAGCATGCAGACTGAGGAAGG + Intergenic
1179321734 21:40298718-40298740 AATGGAGCACAGAATGTGGATGG - Intronic
1180841018 22:18958894-18958916 CATGGCGGGCAGAGTGTGGAGGG - Intergenic
1183522536 22:38303683-38303705 CCTGGCCTACAGGATGAGGATGG + Intronic
949134749 3:550700-550722 GATGAAATACAGAATGTTGATGG + Intergenic
949146187 3:702299-702321 CAGTGCAAACAGCATGTGGAAGG - Intergenic
949661584 3:6284812-6284834 CATAGTATACAGAATCTGGATGG + Intergenic
950168736 3:10821341-10821363 CATGGCAAATAGAATGATGATGG + Intronic
951156272 3:19357338-19357360 TATGGCAAAGAAAATGTGGATGG + Intronic
951309334 3:21105448-21105470 CATAGGATTCAGAATGTAGATGG - Intergenic
951873483 3:27393844-27393866 GATGGAAGACAGAATGAGGATGG + Intronic
952137722 3:30442140-30442162 CTTGGCATATGGAATGTGGATGG - Intergenic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
952669773 3:35952875-35952897 CATAGAATTCAGAATATGGATGG - Intergenic
954123008 3:48511391-48511413 CATGGGATACAGAATATGTGGGG - Intergenic
955337820 3:58101599-58101621 CAAGGCCTTCAGAATGTGGGTGG - Intronic
955907794 3:63825963-63825985 GATGGCTTACACAAGGTGGAGGG + Intronic
956679638 3:71766385-71766407 GATAACATACAGAATGTGGCTGG + Intergenic
957014010 3:75042698-75042720 CATAGAATTCAGAATCTGGATGG - Intergenic
957254912 3:77824813-77824835 CATGGAATTCAGAATCTGGATGG - Intergenic
957563683 3:81858017-81858039 CATGTCATACAGTATATGGGAGG - Intergenic
958029649 3:88092553-88092575 GATGGCAAACAGAATGTTTAAGG + Intronic
959257454 3:104032482-104032504 CATGCAATTCAGAATCTGGATGG + Intergenic
959494308 3:107031278-107031300 CATGGAATTCAGAATCTGGATGG + Intergenic
961627777 3:128275599-128275621 CATGGCTTCCAGAGTGTGGTGGG + Intronic
961918465 3:130401511-130401533 CAGGGCATCCAGTATGTGGATGG - Intronic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964423862 3:156532166-156532188 CATGGGATAGGGAATGGGGATGG - Intronic
964655213 3:159059226-159059248 GATGGCAGACATAATATGGAAGG + Intronic
965120307 3:164546104-164546126 TATGGAATACAGAGTGGGGAGGG + Intergenic
966959158 3:184916082-184916104 CCTGGCATACAAAACATGGAAGG + Intronic
968658841 4:1790512-1790534 GAAGCCATTCAGAATGTGGAGGG + Intergenic
970657761 4:18250568-18250590 AATGGGATACAGATTGGGGAGGG - Intergenic
972321979 4:37980282-37980304 CATTGCATCAAGAATGTGGCTGG + Intronic
972816934 4:42656041-42656063 CATGGCAGGCAGGATGTTGAGGG + Intronic
972915233 4:43868936-43868958 CATGGCACACAAGATGAGGAAGG - Intergenic
972990152 4:44814532-44814554 CCTGTGATACAGCATGTGGAGGG - Intergenic
975059261 4:69977663-69977685 CATAGAATCCAGAATCTGGATGG - Intergenic
975800010 4:78051162-78051184 CATGGCAAAGAGGATATGGAGGG - Intergenic
975900035 4:79140833-79140855 CATAGAATTCAGAATCTGGATGG - Intergenic
976244091 4:82990150-82990172 CATGGCATTCTGAAGGAGGAAGG - Intronic
980135203 4:128852134-128852156 CATGCCATAGAGACTGAGGAAGG + Exonic
980409323 4:132395150-132395172 CATGGCCTTCTGGATGTGGAAGG + Intergenic
980802110 4:137765363-137765385 CATGGGATGCTGAAAGTGGATGG + Intergenic
981401923 4:144322910-144322932 CATGGAATTCTGAATCTGGATGG + Intergenic
982236756 4:153258252-153258274 AATGGCATTCAGAATTCGGAGGG - Intronic
983021124 4:162676311-162676333 CATAGAATTCAGAATCTGGATGG + Intergenic
986014076 5:3742087-3742109 AATGGCATTCAGAATTTTGAGGG + Intergenic
987445847 5:18019072-18019094 CACTGCAGACAGATTGTGGAAGG + Intergenic
987795966 5:22626768-22626790 CATAGAATTCAGAATATGGATGG + Intronic
988052044 5:26042991-26043013 TATGGAATTCAGAATTTGGATGG + Intergenic
988691594 5:33577872-33577894 CATGGCATACAGAATGTGGAGGG - Intronic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
989779409 5:45246560-45246582 CATAGAATTCAGAATCTGGATGG - Intergenic
990348974 5:54896952-54896974 AATGGCATGCAAAATGTAGATGG + Intergenic
990725043 5:58744053-58744075 CATGGCATAGAGTCTGTGTATGG + Intronic
991396008 5:66206128-66206150 CATGGTTTACATAATATGGATGG + Intergenic
991496857 5:67235302-67235324 CAGCGCATTCACAATGTGGAAGG + Intergenic
993944584 5:94102195-94102217 CATAGAATTCAGAATCTGGATGG + Intronic
994060834 5:95475070-95475092 CATAGAATTCAGAATCTGGATGG - Intronic
994529756 5:100954499-100954521 CCTGTCATTCACAATGTGGATGG + Intergenic
996134143 5:119818100-119818122 CACAGCATAGAGAATGTGGAAGG - Intergenic
999089303 5:148921348-148921370 AATGGCATTTGGAATGTGGAAGG + Intergenic
1000605511 5:163323353-163323375 TATGGCATCCAGAATCTTGAAGG - Intergenic
1001808975 5:174612459-174612481 CCTGGCATACACTAAGTGGAAGG + Intergenic
1003057763 6:2838401-2838423 CATGGCAAAAACAATATGGAAGG - Intronic
1004791348 6:19029902-19029924 CATGAATTATAGAATGTGGAAGG - Intergenic
1005115177 6:22328196-22328218 CATGGCACATAGAATGCTGAGGG + Intergenic
1005290946 6:24378273-24378295 CATGGCACACAGAAGCGGGAGGG - Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1008420536 6:51294141-51294163 CATGGTATTCAGCAGGTGGATGG - Intergenic
1008870671 6:56268800-56268822 CATAGAATTCAGAATCTGGATGG + Intronic
1009025210 6:57991338-57991360 CATGACATACAAAATTTGAAAGG + Intergenic
1009032938 6:58081914-58081936 CATAGAATTCAGAATCTGGATGG + Intergenic
1009200783 6:60742790-60742812 CATGACATACAAAATTTGAAAGG + Intergenic
1009208555 6:60833684-60833706 CATAGAATTCAGAATCTGGATGG + Intergenic
1011495533 6:87933597-87933619 CCTGGCATCCAGGATGTGGAGGG + Intergenic
1012037990 6:94166913-94166935 CATAGAATTCAGAATCTGGATGG + Intergenic
1012909615 6:105104298-105104320 AATGTTACACAGAATGTGGAAGG - Intronic
1013824764 6:114197965-114197987 CATGGAATTCAGAATCTGGATGG + Intronic
1014022488 6:116606921-116606943 CATAGAATTCAGAATATGGATGG + Intergenic
1015853451 6:137598833-137598855 CAGGGCATGCAGAATGCTGATGG - Intergenic
1016568336 6:145484570-145484592 AATTACATACAGAATGTAGATGG - Intergenic
1018107829 6:160506102-160506124 CATGGAATTCAGAATCTGGGTGG - Intergenic
1018145072 6:160878047-160878069 CATGGAATTCAGAATCTGGACGG + Intergenic
1018196766 6:161362162-161362184 CATGGCATACTGCATGTGAAGGG + Intronic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1023905286 7:44517367-44517389 CATGGCACACAGAAGATGGAAGG + Intronic
1024063020 7:45713133-45713155 TAGGGCATACAGAATGTAGGGGG - Intronic
1024452627 7:49564732-49564754 CATAGAATGCAGAATCTGGATGG + Intergenic
1027714460 7:81652879-81652901 GATGTCATACAGAGTGTGAAGGG + Intergenic
1027994944 7:85413931-85413953 CAGGGCAGGCAGAATCTGGAGGG - Intergenic
1030419600 7:109291476-109291498 CAAGGCAAACAGAATATTGATGG - Intergenic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1034036084 7:147823998-147824020 CAAGGCATTCAGAAGGTGTATGG + Intronic
1034817145 7:154182387-154182409 CATGGCAACCAGCATGAGGAGGG - Intronic
1035646064 8:1222051-1222073 CATGGAATTCAGAATCTGGATGG - Intergenic
1035981032 8:4372358-4372380 AATGGAAAACAGCATGTGGAAGG - Intronic
1037316707 8:17606019-17606041 CATGTCATCCAGCATCTGGAGGG + Intronic
1037389938 8:18382811-18382833 CATGGCTTACAAAATGGGGTAGG - Intergenic
1039215968 8:35271955-35271977 CATGGCAAACACAGTATGGATGG + Intronic
1041855523 8:62449336-62449358 AATGGAATACAGCAGGTGGATGG - Intronic
1043111297 8:76186399-76186421 CATGGCAGACAGAAAGGAGAAGG + Intergenic
1043761490 8:84074816-84074838 CATAGAATTCAGAATCTGGATGG - Intergenic
1043775260 8:84259310-84259332 CATGGAATACAGAAGTTGGAGGG - Intronic
1044026816 8:87183502-87183524 CATAGAATTCAGAATCTGGATGG - Intronic
1044185992 8:89253105-89253127 CATAGAATTCAGAATCTGGATGG - Intergenic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1046129779 8:109953467-109953489 CATAGAATTCAGAATCTGGATGG - Intergenic
1047635321 8:126755535-126755557 CTTGGCCAACAGAATGTGGGTGG + Intergenic
1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG + Intronic
1050391449 9:5148007-5148029 TATGGAATTCAGAATCTGGATGG - Intronic
1050784249 9:9379494-9379516 AATGGCAAACAGAATGTTGAAGG - Intronic
1050987188 9:12097900-12097922 AAAGGAATACAGAAAGTGGATGG - Intergenic
1051689444 9:19694855-19694877 CATGGCATACAGAGTGAAAATGG + Intronic
1051885807 9:21891311-21891333 CATTGAATTCAGAATCTGGATGG + Intronic
1052157201 9:25207009-25207031 AATGGCATACACAAAGTGTAGGG - Intergenic
1052271958 9:26636434-26636456 CAGGGCCAAAAGAATGTGGAAGG - Intergenic
1052363994 9:27590471-27590493 CATAGAATTCAGAATCTGGATGG + Intergenic
1052551259 9:29952171-29952193 CATAGGATTCAGAATATGGATGG - Intergenic
1052760752 9:32588609-32588631 TCTGGCAAATAGAATGTGGATGG - Intergenic
1053542938 9:38993622-38993644 CATGGCACACACACTGTGGCAGG + Intergenic
1053807381 9:41817139-41817161 CATGGCACACACACTGTGGCAGG + Intergenic
1054623211 9:67370288-67370310 CATGGCACACACACTGTGGCAGG - Intergenic
1055813902 9:80183021-80183043 AATGGCAGAGACAATGTGGAAGG + Intergenic
1056832025 9:89924877-89924899 CAGGGCATACAGAATGGGAGAGG - Intergenic
1057136990 9:92698468-92698490 CATAGAATTCAGAATCTGGATGG - Intergenic
1057628095 9:96695997-96696019 CATGGCCACCAGAATGTGGATGG + Intergenic
1057826411 9:98375673-98375695 CCTGTCAGACAGCATGTGGAAGG - Intronic
1059320066 9:113462472-113462494 CATGGCCAACAGCAGGTGGAAGG - Intronic
1061144871 9:128791718-128791740 CCCAGGATACAGAATGTGGAGGG + Intronic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1186149252 X:6656585-6656607 CATAGCATAAAGGATGTGGAGGG + Intergenic
1186666930 X:11726663-11726685 TATGGCATAGAGACTGTGGGTGG - Intergenic
1187115452 X:16345624-16345646 CATCGAATTCAGAATCTGGATGG - Intergenic
1188147253 X:26629604-26629626 CATAGAATTCAGAATTTGGATGG - Intergenic
1189118759 X:38370936-38370958 CATGGCACCCAGCATGAGGAAGG - Intronic
1189600362 X:42617517-42617539 AATGGCAGGCAGATTGTGGAGGG - Intergenic
1190604618 X:52127684-52127706 CATAGAATTCAGAATCTGGATGG + Intergenic
1190773847 X:53537033-53537055 CATGGCATACAGTCTGTCTAGGG + Intronic
1192918019 X:75674475-75674497 CATGGAATTCAGAATGTGGCTGG + Intergenic
1193557224 X:82969917-82969939 AATTGAATACAGAATGTGGGAGG - Intergenic
1193570461 X:83135465-83135487 AAAGACATAGAGAATGTGGAAGG + Intergenic
1193834360 X:86323516-86323538 CATTGCATACAGAGAGGGGATGG + Intronic
1193869574 X:86780364-86780386 CATAGTATTCAGAATATGGATGG + Intronic
1193882026 X:86935492-86935514 CATAGAATTCAGAATCTGGATGG - Intergenic
1194010227 X:88553039-88553061 CATAGAATTCAGAATCTGGATGG - Intergenic
1194100053 X:89693217-89693239 AATAGAATACAGAATCTGGATGG - Intergenic
1196608996 X:117689460-117689482 CATGGATCACAAAATGTGGATGG - Intergenic
1197258337 X:124288519-124288541 CCTGTCATTCACAATGTGGATGG - Intronic
1198277661 X:135111952-135111974 CATGGAATTCAGTATCTGGATGG - Intergenic
1198577655 X:138027352-138027374 CATAGAATTCAGAATCTGGATGG + Intergenic
1198609737 X:138384184-138384206 CATAGAATTCAGAATCTGGATGG + Intergenic
1198694286 X:139319458-139319480 GATGGCAAATAGAATGTGGGTGG + Intergenic
1199643354 X:149883311-149883333 CATGGCTGACAGAAGGTGCAGGG - Exonic
1199879127 X:151959018-151959040 CATCGTTTCCAGAATGTGGATGG - Intronic
1200453055 Y:3354576-3354598 AATAGAATACAGAATCTGGATGG - Intergenic
1200738730 Y:6830047-6830069 CATGGCATTCTCACTGTGGAAGG - Intergenic
1202183000 Y:22155558-22155580 CATGGCATTCTCATTGTGGAGGG - Intergenic
1202208359 Y:22430843-22430865 CATGGCATTCTCATTGTGGAGGG + Intergenic