ID: 988691812

View in Genome Browser
Species Human (GRCh38)
Location 5:33580136-33580158
Sequence TCAACCTAAAAGGGTAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988691807_988691812 21 Left 988691807 5:33580092-33580114 CCAATAACAAGAACTAAGTAATC 0: 1
1: 0
2: 0
3: 6
4: 177
Right 988691812 5:33580136-33580158 TCAACCTAAAAGGGTAAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988691812 Original CRISPR TCAACCTAAAAGGGTAAGGC AGG Intronic
900080268 1:851488-851510 TCACCCTCAGAGGGTGAGGCGGG + Intergenic
902274919 1:15332459-15332481 TCAACATAAGAGGCTGAGGCAGG + Intronic
904126533 1:28244191-28244213 TCAAGGTAAAAGTGTAAGGCAGG - Intronic
904746713 1:32715933-32715955 TCAAGGTAGAAGGGTTAGGCCGG - Intergenic
905963680 1:42069290-42069312 TCAACTTAAAAGAATAATGCAGG - Intergenic
906010718 1:42522428-42522450 TAAACATAAAAGGGTAATGCAGG - Intronic
907483949 1:54764143-54764165 CCAACATAAAACGGGAAGGCTGG + Intronic
908353295 1:63307484-63307506 TCAACATAAAATGGTAGGACAGG - Intergenic
909633876 1:77794083-77794105 TCAAAATAAAAGTTTAAGGCCGG - Intronic
911900900 1:103502522-103502544 TCAACATCAAAGGGTAATGAAGG + Intergenic
912146756 1:106803616-106803638 TTAACTTAAAAGGTTAATGCTGG + Intergenic
912540197 1:110408977-110408999 TGAACCTAGAAGGCTGAGGCTGG - Intergenic
913147872 1:116010236-116010258 GCAACCAAAAAGTGTAAGGTTGG + Intronic
915050248 1:153062646-153062668 TCAACCTAAAATTGTACAGCCGG + Intergenic
915081776 1:153357541-153357563 TCAACCTCAAAGGGGATGGGGGG + Intergenic
919327177 1:196123541-196123563 TCAAACTAAAAGAGTAAGTATGG + Intergenic
924771228 1:247081211-247081233 TTAACAAAAAAGGGTGAGGCCGG - Intergenic
1064511248 10:16094788-16094810 TCAAACTAAAAGGATAATACAGG + Intergenic
1066393718 10:34999071-34999093 TCAACCGAGATGGGCAAGGCTGG + Intergenic
1067508931 10:46878988-46879010 TCAAGTCAAAAGGGAAAGGCAGG + Intergenic
1067653319 10:48172862-48172884 TCAAGTCAAAAGGGAAAGGCAGG - Intronic
1067694065 10:48523134-48523156 TAAACCATATAGGGTAAGGCAGG - Intronic
1068021818 10:51594881-51594903 TCAACCAAAAAGGCATAGGCTGG + Intronic
1070813751 10:79311122-79311144 TCAGCCTTAGAGGGTCAGGCCGG + Exonic
1072975933 10:100057864-100057886 TTAACTTAAAAGGTTAATGCTGG + Intronic
1085351235 11:75799155-75799177 TCTACCTAAAAGTACAAGGCAGG - Intronic
1088323956 11:108583040-108583062 TCAACCCACAACAGTAAGGCTGG + Intronic
1088998231 11:115023056-115023078 ACAACCAAAAGGGGTAGGGCGGG + Intergenic
1094661495 12:32473731-32473753 CCAACATATAATGGTAAGGCAGG + Intronic
1095844703 12:46732259-46732281 TCAACCTTCAAAGGTAAGGTGGG - Intergenic
1098477859 12:70926278-70926300 TAAAACTAAAAGTTTAAGGCCGG + Intergenic
1099121497 12:78695247-78695269 TCAACCTAAAAGGAAGAAGCTGG - Intergenic
1102365080 12:112326379-112326401 GCTACCTAAAAGGCTGAGGCAGG + Intronic
1103141041 12:118548654-118548676 CCAACCTACAATGGTGAGGCAGG - Intergenic
1103796785 12:123508705-123508727 TCAATTTAAAATGTTAAGGCCGG + Intronic
1106416283 13:29548658-29548680 CCTACCTAAAAGGAGAAGGCTGG - Intronic
1121018909 14:90567019-90567041 TCAATTTGAAAGGGGAAGGCGGG + Intronic
1122812933 14:104297911-104297933 TCACCCCACAAGGGTCAGGCCGG - Intergenic
1124855885 15:33388365-33388387 TCAACCCAATAGAGTAAGGAAGG + Intronic
1126206902 15:46056413-46056435 TTAAGGTAAGAGGGTAAGGCTGG - Intergenic
1126940287 15:53759270-53759292 TTATCCTAATAGGGAAAGGCAGG + Intronic
1129033784 15:72637696-72637718 TCAACCTTAAAGGCGATGGCAGG + Intergenic
1129216097 15:74099520-74099542 TCAACCTTAAAGGCGATGGCAGG - Intergenic
1131192886 15:90331429-90331451 GCAACATAAAATGGTAAGGTGGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1143100898 17:4504160-4504182 GCCACCTAAGAGGGCAAGGCAGG - Intronic
1144110817 17:12030087-12030109 TCATACTCAAAGGGTAAGGATGG - Intronic
1145400681 17:22529715-22529737 TTAACTTAAAAGGTTAATGCTGG - Intergenic
1146033843 17:29389609-29389631 AGAACCTAAAAGTGTAAGGCCGG - Intergenic
1146378893 17:32314161-32314183 TCTACCTAAAAAGGGAAGGCAGG + Intronic
1148581022 17:48743811-48743833 TCAGCTTAGAAGGGTAAAGCAGG - Intergenic
1150361231 17:64536164-64536186 TTATTTTAAAAGGGTAAGGCTGG + Intronic
1153929654 18:9866904-9866926 GGAACCTAAAAGGGCAAGCCTGG - Intergenic
1153996767 18:10449360-10449382 TCAAGCTAAAGGGGAAAGGTAGG - Intergenic
1154064103 18:11090508-11090530 CCAACCTGAAAGGGTAGGGGTGG + Intronic
1157428913 18:47607235-47607257 TCAACCTATGATGGTAAGGCTGG + Intergenic
1158686662 18:59620959-59620981 GAAACCACAAAGGGTAAGGCAGG + Intronic
1165467053 19:35981014-35981036 TGACCCAAAAAGGGTAAGTCAGG - Intergenic
1165947534 19:39453338-39453360 TCTACCTACAGGGGTCAGGCAGG - Exonic
1167966640 19:53153121-53153143 TCAACCTAAATGGAAAATGCAGG - Intronic
928210912 2:29322960-29322982 GCCTCCTAAAAGGGTAAGGAGGG - Intronic
928471761 2:31582026-31582048 TCAACCTAAAGGAGAAAGCCGGG - Intergenic
928668691 2:33578155-33578177 ACAACCTAAAAGGATGAGCCAGG - Intergenic
932737596 2:74265260-74265282 TCCACCTGGAAGGGTAAGGATGG + Exonic
937758583 2:125571700-125571722 TCCTCCTATAGGGGTAAGGCTGG + Intergenic
939068847 2:137516083-137516105 TCAACCAACAAAGGTAAGGTGGG + Intronic
939079479 2:137642470-137642492 TCGACCTAAAATGATAAGGGAGG - Exonic
939510685 2:143100805-143100827 TTAACTTAAAAGGTTAATGCTGG + Intronic
944627041 2:201581390-201581412 ACAACCTAAAAGTGTAAGTGTGG + Intronic
945876656 2:215285024-215285046 GCAACTTAACAGGGTGAGGCAGG - Intergenic
1170089359 20:12573566-12573588 TCAACCTGAAAGGCAATGGCAGG - Intergenic
1170118350 20:12885622-12885644 ACAACCCAGAAGGGTAAGGCAGG - Intergenic
1173295774 20:41755111-41755133 TCAAAGTAAAAAGATAAGGCCGG - Intergenic
1175077380 20:56387532-56387554 TCAAACTAAAAGGGGTAGGAGGG + Intronic
1176552647 21:8235574-8235596 TCAACATAAACTGTTAAGGCCGG + Intergenic
1176571545 21:8417977-8417999 TCAACATAAACTGTTAAGGCCGG + Intergenic
1176579457 21:8462540-8462562 TCAACATAAACTGTTAAGGCCGG + Intergenic
1179443179 21:41410410-41410432 TCAACCTAAAAGGAAGAAGCTGG + Intergenic
1181688206 22:24543552-24543574 GCAGCATGAAAGGGTAAGGCAGG + Intronic
1183003609 22:34881607-34881629 TCAAGGTAGAAGGGTGAGGCTGG - Intergenic
949716957 3:6944500-6944522 TCATCCTAAAAATGTAAGGCTGG - Intronic
952096329 3:29959409-29959431 TGAACCCAAAAGGGTTGGGCAGG + Intronic
953710134 3:45263198-45263220 TTAACATACAAGGGTAGGGCAGG + Intergenic
954383373 3:50231569-50231591 TCAACTTAAATGAATAAGGCCGG - Intronic
954459195 3:50617017-50617039 TCAGCCTTAAAGGGCCAGGCGGG - Intronic
961201568 3:125049655-125049677 GCCACTTAAAAGAGTAAGGCTGG - Intronic
965681051 3:171251848-171251870 TCATTCTAAACGGGTAAGGAAGG + Intronic
966005696 3:175008717-175008739 ACAACGTTATAGGGTAAGGCAGG + Intronic
968393951 4:215873-215895 TCGACCTAAAAGGAAAAAGCTGG - Intergenic
970961651 4:21878370-21878392 TCAAATCAAAAGGGCAAGGCCGG - Intronic
971186313 4:24380473-24380495 TCATCCAAAAAGGATGAGGCTGG - Intergenic
973990296 4:56398946-56398968 TCAATATAAAAGCTTAAGGCTGG - Intronic
975515495 4:75243180-75243202 TCACCCTAAACTGGTAAGGAGGG + Intergenic
979986741 4:127325164-127325186 TCCACCTAAATGGGGAAGCCTGG + Intergenic
985721215 5:1490230-1490252 TCAACCCACAGGGGGAAGGCGGG - Intronic
988338018 5:29931372-29931394 TCAACCTAAAAGCAAAAAGCTGG + Intergenic
988691812 5:33580136-33580158 TCAACCTAAAAGGGTAAGGCAGG + Intronic
989484263 5:41970242-41970264 TAAACCTAAAATGGAAATGCTGG + Intergenic
989488131 5:42015935-42015957 GCAAGCTAAAAGGGAATGGCTGG + Intergenic
990048773 5:51468890-51468912 TCACCCTGAAAGAGTAAGTCAGG + Intergenic
990730944 5:58808481-58808503 TCAACCTAAAATAATAAGGTTGG - Intronic
999164700 5:149538624-149538646 TCAACCTAACAGTGAATGGCTGG + Intronic
999240852 5:150126596-150126618 ACCACCTTAAAGGGCAAGGCTGG + Exonic
999511058 5:152252055-152252077 CCTACCTAAAAGGATAAGGAAGG - Intergenic
999892899 5:155998617-155998639 TCAACCTTAAATTGTAGGGCTGG + Intronic
1007055039 6:38874479-38874501 ACAACTTCAAAGGCTAAGGCAGG - Intronic
1010205104 6:73315305-73315327 TTTACCTAAATCGGTAAGGCTGG - Intergenic
1013507981 6:110818140-110818162 TCGACCTAAAAGGAAAAAGCTGG + Intronic
1013598135 6:111679557-111679579 TCAGCCAAAAAGGGAAGGGCTGG - Intronic
1014363029 6:120504358-120504380 TAAACATAAAAGAGTAATGCAGG - Intergenic
1014910407 6:127085789-127085811 TCAAGCTAAAATGATAATGCAGG + Intergenic
1017734043 6:157344570-157344592 TCAAACTAAAAAGCTAGGGCTGG - Intergenic
1021171722 7:17405497-17405519 TCAAGATAAAAAGGGAAGGCTGG + Intergenic
1021897999 7:25255695-25255717 TCAGCCAAAAAGGGTGGGGCGGG + Intergenic
1025925691 7:65958169-65958191 TCAAACAAAAAGGGCAAGGGTGG + Intronic
1027695011 7:81399423-81399445 TCAACATACAATGGTGAGGCAGG + Intergenic
1032925149 7:136595857-136595879 TAAACCTAAGAGGGCAAGGAGGG + Intergenic
1035525245 8:307425-307447 TCACCCTCAGAGGGTGAGGCGGG - Intergenic
1036538814 8:9682329-9682351 TCAAAGTAGAAGGGTAAGGAAGG - Intronic
1038718344 8:30011686-30011708 TCTTCCTAAAAGGGTAAGTGTGG - Intergenic
1038828860 8:31034615-31034637 TCTACCTAAAAGGAAGAGGCTGG + Intronic
1040982672 8:53260228-53260250 GCAACCTGGAAGGGTGAGGCAGG + Intergenic
1045517122 8:102869733-102869755 TCAACATAAATAGGTAAGGCTGG + Intronic
1047556273 8:125934153-125934175 TCAACATCTAAGAGTAAGGCCGG + Intergenic
1050526177 9:6548793-6548815 TCACCCTGGAAGGGAAAGGCTGG - Intronic
1051475473 9:17503444-17503466 GGAACCAAAAAGGGTATGGCAGG - Exonic
1051501408 9:17781846-17781868 TCCACCTGAAAGAGTAAGGCTGG - Intronic
1053317725 9:37066417-37066439 TACACCTAAAAGGGCAAGGAAGG + Intergenic
1057360092 9:94365447-94365469 TCAACTTAAAAGTGTAGGGGGGG - Intergenic
1057419098 9:94894855-94894877 TTATCCTAAAAGTGTAAGGATGG + Intronic
1057588266 9:96348774-96348796 ACAATCTAAAAGGGTAAATCGGG - Intronic
1057663248 9:97022641-97022663 TCAACTTAAAAGTGTAGGGGGGG + Intergenic
1060174610 9:121488259-121488281 ACATCCTAACAGGCTAAGGCGGG - Intergenic
1061600796 9:131668869-131668891 TCCACCTAAAAGACAAAGGCCGG - Intronic
1203473818 Un_GL000220v1:133998-134020 TCAACATAAACTGTTAAGGCCGG + Intergenic
1188462386 X:30443767-30443789 TCAACCTAAATGAGAAAGGGAGG + Intergenic
1189480294 X:41387356-41387378 TCAACCTAAAAGGAAGAAGCTGG - Intergenic
1191661617 X:63657433-63657455 TCAACCTCAAAGGCCCAGGCTGG + Intronic
1191833408 X:65439245-65439267 TCAACCTCAAATGATATGGCTGG - Intronic
1194488507 X:94517094-94517116 TCAACATCTAAGGGTCAGGCTGG - Intergenic
1196490584 X:116261092-116261114 TCAAGTTAAAAGTGCAAGGCAGG + Intergenic
1198792329 X:140358955-140358977 GCAACCAAAAAGGGTATGACTGG + Intergenic
1200014631 X:153149033-153149055 ACAGCTTAAAAGGGTAAGGAAGG - Intergenic
1200024970 X:153250919-153250941 ACAGCTTAAAAGGGTAAGGAAGG + Intergenic