ID: 988695138

View in Genome Browser
Species Human (GRCh38)
Location 5:33614307-33614329
Sequence CATTGTCAAGGCCATCTTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988695136_988695138 3 Left 988695136 5:33614281-33614303 CCAGAAGTACATCTGCTGCTCAA 0: 1
1: 0
2: 2
3: 11
4: 112
Right 988695138 5:33614307-33614329 CATTGTCAAGGCCATCTTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 158
988695135_988695138 11 Left 988695135 5:33614273-33614295 CCGTACTGCCAGAAGTACATCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 988695138 5:33614307-33614329 CATTGTCAAGGCCATCTTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 158
988695134_988695138 18 Left 988695134 5:33614266-33614288 CCAGTGGCCGTACTGCCAGAAGT 0: 1
1: 0
2: 0
3: 7
4: 95
Right 988695138 5:33614307-33614329 CATTGTCAAGGCCATCTTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988695138 Original CRISPR CATTGTCAAGGCCATCTTTC TGG Exonic
902357006 1:15911108-15911130 CATGGAAAAGGCCATCTTTAAGG - Exonic
903454463 1:23477630-23477652 CCTCGTCAAGGCCTTCTTTGAGG - Intronic
904372355 1:30057758-30057780 CATTCTCAAGGTCACCTTGCAGG + Intergenic
905176570 1:36139707-36139729 CATTGCCAAGGTCATTATTCTGG - Exonic
907706320 1:56835652-56835674 CATGGCCAAGGGCATCTTTATGG - Intergenic
909404984 1:75278371-75278393 CAGTGTCAAGGGCTTCTTTAAGG + Intronic
910193342 1:84616755-84616777 CATTGTCACTGCCCTATTTCAGG - Intergenic
916533748 1:165683050-165683072 CAATGGCAAGTCCATCTTTGAGG - Exonic
917250748 1:173058002-173058024 CATGGTCAAGTCCTTCTTTGGGG - Intergenic
919213498 1:194519758-194519780 CATAGTCAGGGCTTTCTTTCTGG + Intergenic
919918969 1:202156987-202157009 CTTTCTCAAAGCCATCTCTCTGG + Intronic
1064133445 10:12730323-12730345 CATGGGCAACTCCATCTTTCAGG - Intronic
1064703400 10:18045754-18045776 CATAGACAGGGCCATCTTTAGGG + Intergenic
1064707844 10:18091181-18091203 CATTGTAAAGGGCAATTTTCCGG + Intergenic
1064864359 10:19862414-19862436 TATTTTCAAGGCACTCTTTCAGG + Intronic
1066442391 10:35450589-35450611 CATTGGGAAGGGCATCTTGCGGG + Intronic
1068948842 10:62757137-62757159 TATTTTCAAAGGCATCTTTCTGG + Intergenic
1069400833 10:68044368-68044390 GATTGTTAAGGACCTCTTTCTGG + Intronic
1070600749 10:77864761-77864783 CATTGTCAAGGACATCAGTGGGG - Intronic
1071478121 10:86042195-86042217 GATTGCGAAAGCCATCTTTCTGG - Intronic
1071732502 10:88262471-88262493 CACTGGCATGGCCATCTTCCTGG - Intergenic
1072319636 10:94235995-94236017 CACTGTCAACAGCATCTTTCAGG + Exonic
1073092099 10:100950902-100950924 CATTATCATGCCCCTCTTTCTGG - Intronic
1073566505 10:104539966-104539988 CCTTGTCAAGGGCTTCTTTGGGG - Intergenic
1078776503 11:14398800-14398822 CATTATTAAGGTCATCTTTGAGG + Intergenic
1079003941 11:16779556-16779578 CATTGTGAAGGCCACATTTGAGG - Intronic
1079259399 11:18863865-18863887 CCTGGTCAAGGGCATCTTCCGGG + Intergenic
1079839946 11:25383494-25383516 CACTCTCAATGCCTTCTTTCTGG + Intergenic
1081043795 11:38246301-38246323 CATTGTCTTGGGCATTTTTCTGG + Intergenic
1085624847 11:78064064-78064086 CATGCTCAAGGCCATCTGTGTGG + Exonic
1088358731 11:108969422-108969444 CATCATCAAGGCCATGTTTCTGG - Intergenic
1088418642 11:109618311-109618333 CATTGTCAAGGGCATATCTTTGG - Intergenic
1088634338 11:111805247-111805269 TCTGGTAAAGGCCATCTTTCTGG - Intronic
1089736077 11:120551032-120551054 CCTTCTCAAGGCCTTCATTCTGG - Intronic
1091696327 12:2630548-2630570 CAATTTCAGGGCCAGCTTTCAGG - Intronic
1096034737 12:48456618-48456640 AATTGTCAAAGCCATTTTCCAGG - Intergenic
1096973565 12:55685541-55685563 CACCCTCAAGGCCCTCTTTCAGG - Intronic
1100009772 12:89939255-89939277 CATTCTCCAGGCCCTTTTTCAGG + Intergenic
1101074106 12:101110249-101110271 CAGTCTCCTGGCCATCTTTCTGG + Intronic
1106090896 13:26592477-26592499 CCTGGTGAGGGCCATCTTTCTGG + Intronic
1107399137 13:40051757-40051779 CTGTGTCAAGGCCATCCTTAGGG + Intergenic
1112276552 13:98026670-98026692 CACTGTCAAGGCCATTGTACAGG + Intergenic
1112325759 13:98441869-98441891 CATCTTCAAAGCCAACTTTCAGG - Intronic
1113131671 13:107043500-107043522 CAGTCTCAAGGCATTCTTTCAGG + Intergenic
1114953681 14:27790280-27790302 CAAAGTAAAGGCTATCTTTCCGG + Intergenic
1115593495 14:34886710-34886732 CATTGCCAAGGCAATAATTCAGG - Intergenic
1116788548 14:49314720-49314742 CATATTCAGGTCCATCTTTCAGG + Intergenic
1117940659 14:60960690-60960712 CAGTGTCAAGGTCAACTTCCAGG - Intronic
1120846817 14:89133578-89133600 CAGAGTCAAGGCCAGCTGTCTGG - Intronic
1121889214 14:97573566-97573588 ACATGTCAAAGCCATCTTTCAGG - Intergenic
1122402556 14:101475826-101475848 CATTGTCAAGGCCAGCACTTTGG + Intergenic
1124063228 15:26315054-26315076 CATTTTCATGGCCATTTTTCAGG + Intergenic
1125343294 15:38695555-38695577 CATTGTCATGGTGATCTTTGCGG + Intergenic
1130714759 15:86322041-86322063 AATTGTTAAGGCTATCTTTATGG + Intronic
1131257929 15:90873687-90873709 CATTGATCAGGCCAGCTTTCTGG + Intronic
1135645648 16:24159372-24159394 CATTGTCAAGGCCATTTTGGTGG - Intronic
1137723222 16:50639921-50639943 CTTGGTCAAGGCCAGCTTTGGGG + Exonic
1137932526 16:52602594-52602616 CATTGACAAAGCCATCTGTGAGG + Intergenic
1140654033 16:77121632-77121654 GATTGTCAGAGCCCTCTTTCAGG + Intergenic
1140826430 16:78711008-78711030 GTTTGTCAAGGCCAGATTTCAGG + Intronic
1147846028 17:43404349-43404371 CATTTCCAAGGCCATCTGTTGGG + Intergenic
1155483726 18:26317689-26317711 CTTGGTGAAGGCCTTCTTTCTGG + Intronic
1157103371 18:44750272-44750294 CCTGGTGAAGGCCCTCTTTCTGG + Intronic
1158090992 18:53713364-53713386 CATGGTGAGGGCCCTCTTTCAGG - Intergenic
1158623907 18:59055710-59055732 CATTGTCAAAGGCATTTTCCAGG + Intergenic
1159377382 18:67610507-67610529 AATTGGGAATGCCATCTTTCTGG + Intergenic
1160186472 18:76680224-76680246 CAGTCTCAAAGCCATCTTGCTGG + Intergenic
1161900872 19:7118070-7118092 CCTTTTCAAAACCATCTTTCAGG - Intronic
1165130070 19:33626394-33626416 CATTGCCAAAGCCACCTTTTAGG + Intronic
926860786 2:17306457-17306479 CATTGTCTAGGACTGCTTTCAGG + Intergenic
932104102 2:68927154-68927176 CATTTTTAAGGGCTTCTTTCTGG + Intergenic
932157336 2:69430143-69430165 CATTTTCATGAGCATCTTTCTGG - Intronic
938295296 2:130174443-130174465 CCTTGTCTAGGCCAGCTTCCTGG + Intronic
938461328 2:131499403-131499425 CCTTGTCTAGGCCAGCTTCCTGG - Intergenic
943762145 2:191621727-191621749 CACTGCCAAGGCCTTCTTCCAGG - Intergenic
944109676 2:196118905-196118927 CATTGTCAAGGCCTTCTGCTGGG - Intergenic
947460053 2:230296332-230296354 CAGTGACAAGGTCATCTCTCAGG + Intronic
1169189841 20:3651597-3651619 CATTGGCAAGGCCTTGTTTGGGG + Intergenic
1171467667 20:25342315-25342337 CAGTGACCTGGCCATCTTTCAGG - Intronic
1173585457 20:44179534-44179556 TATTGTCAAGGCCAGCTTCATGG + Intronic
1173738141 20:45376193-45376215 TTCTGTCAAGGCCACCTTTCTGG - Intronic
1177074424 21:16554287-16554309 CAGTGTCTAAGCCATATTTCTGG + Intergenic
1177530258 21:22349715-22349737 CCTTGACAAGGCCATCTCTGAGG + Intergenic
1179192045 21:39131582-39131604 CATTGTCATATCCATCTTGCTGG - Intergenic
1181114630 22:20623627-20623649 CCTTGTCTAGGCCAGCTTCCTGG + Intergenic
1181424366 22:22823392-22823414 AATTGTCAAGGCCATCCTGCAGG - Intronic
1181754560 22:25014245-25014267 CTATGTCATGACCATCTTTCAGG - Intronic
1184295651 22:43522800-43522822 CCTTGCAAAGGGCATCTTTCAGG + Intergenic
1184704543 22:46201576-46201598 CATTGTCAAGGCCATTAACCCGG - Intronic
1185122031 22:48977078-48977100 CTGTGACAAGGCCTTCTTTCAGG + Intergenic
954526355 3:51275185-51275207 CATCGTCAAGACCAGCTCTCTGG + Exonic
956219419 3:66885900-66885922 AATTGTCAAGGCAATTTTTAAGG + Intergenic
956261812 3:67351422-67351444 CTTGGTGAAGGCCATCTTCCTGG + Intergenic
960575885 3:119228950-119228972 CATGGTCAGGGCCCTCTTACTGG - Intronic
962086163 3:132194099-132194121 CATTGGCAAGGACTTCTCTCAGG + Intronic
964441738 3:156718339-156718361 CATGGTCAAGGCGATCATGCAGG + Intergenic
964753702 3:160075867-160075889 CTTTTTCAAGTCCATCTTTGTGG + Intergenic
964874304 3:161348396-161348418 CTTTCTCAAGGCCATCATTAAGG - Intronic
969592360 4:8129214-8129236 CACTCTCAATGCCATCTTTAAGG + Intronic
972789989 4:42362261-42362283 CATTCACAAAGCCATCTTCCTGG - Intergenic
976365471 4:84228419-84228441 CAGTGCCAAGGACATCTTGCAGG + Intergenic
977152235 4:93526967-93526989 CTTTGTCAAAAACATCTTTCAGG + Intronic
977752492 4:100626177-100626199 TATTGTCTAGGCCGTCTTCCAGG - Intronic
979430827 4:120628269-120628291 CATTGCCAAGGCCAGCATCCAGG - Intergenic
980307299 4:131078647-131078669 TAATGTCAAGGGCATTTTTCAGG + Intergenic
986804805 5:11299783-11299805 AAATGTCAAGGCCTTCTTTGTGG - Intronic
987196647 5:15533613-15533635 CATTGTTTAGGCGATTTTTCTGG - Intronic
988695138 5:33614307-33614329 CATTGTCAAGGCCATCTTTCTGG + Exonic
989093262 5:37756610-37756632 CATTTTGAAAACCATCTTTCTGG + Intergenic
990605999 5:57410793-57410815 CCTTCTCAAATCCATCTTTCTGG - Intergenic
995214085 5:109574709-109574731 CACTGCCAAGGACACCTTTCTGG + Intergenic
996523733 5:124455089-124455111 TATTGTTAACCCCATCTTTCAGG - Intergenic
998690391 5:144581210-144581232 CATTTTCAGGGCCATCATTTTGG - Intergenic
999157246 5:149466919-149466941 CATTATCAAGGCTTTCATTCAGG - Intergenic
1001251580 5:170151261-170151283 CATTATCAAGGCCACATTCCTGG + Intergenic
1002672471 5:180879297-180879319 TATTGTCAAGGCCAACGTTGAGG + Intergenic
1004789145 6:19004985-19005007 TATTGAAAAGGCCATCTTTCCGG + Intergenic
1007447850 6:41920934-41920956 CATGGTCAAGGTCCTCTTTCCGG + Intronic
1007659100 6:43471514-43471536 CACTTTCAAGGCCAACTTTCAGG + Intergenic
1007834462 6:44664001-44664023 CAGGGTCAAAGCCATCTCTCCGG + Intergenic
1011706720 6:90007952-90007974 CATTGTGAAGCCCATCTTTTGGG + Intronic
1015360528 6:132334039-132334061 CGTTGTCAAGGTCAGCTTTATGG - Intronic
1016563619 6:145425696-145425718 TATTGTGAAGGCCAGATTTCAGG + Intergenic
1018218002 6:161549687-161549709 CATTTTCAAGGTCTTCTTTGTGG + Intronic
1021037407 7:15817046-15817068 CATGGTCAAAGCCATGTTTTAGG + Intergenic
1021404819 7:20252836-20252858 CATTGCCAAGGCCAACATTAAGG - Intergenic
1021600750 7:22360960-22360982 CATTGTCAGAGCTATCTTCCTGG - Intergenic
1021754220 7:23835254-23835276 GGTTGTCAAGGAAATCTTTCTGG + Intergenic
1023599326 7:41865665-41865687 CACTGTCATGTCCATCTTTGAGG - Intergenic
1028274063 7:88829301-88829323 CATTGACCAGGCCATAGTTCTGG + Intronic
1030929832 7:115508564-115508586 CATTTTCAAGCCCATTTTGCAGG - Intergenic
1031665806 7:124480966-124480988 CATTCTCGGGGCCATCATTCTGG + Intergenic
1034548951 7:151808193-151808215 CATTGTCAAGTGCATCTGGCAGG + Intronic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1035048404 7:155983988-155984010 CCTGGTCATGCCCATCTTTCAGG + Intergenic
1038832550 8:31077540-31077562 CATTTTAAAGTTCATCTTTCAGG - Intronic
1041623007 8:59995253-59995275 CAGTGGCAACTCCATCTTTCTGG + Intergenic
1042731522 8:71940065-71940087 CATTTTCAAGGACATTTTTGTGG + Intronic
1043494994 8:80790936-80790958 CATTGCCAGGGCCATGTCTCAGG + Intronic
1044004296 8:86923019-86923041 CACTCTCAAGGCCCTCCTTCTGG - Intronic
1044762924 8:95541256-95541278 CATTGCCTAGGCCGTCTTCCAGG + Intergenic
1048644893 8:136409227-136409249 CATTGTCTGAGCCTTCTTTCAGG + Intergenic
1050044547 9:1529271-1529293 CAATGCCAAGGCCTTCTTTGGGG - Intergenic
1050132006 9:2422576-2422598 CAGCCTCAAGGCCACCTTTCAGG - Intergenic
1053540072 9:38964225-38964247 CATTTTCAAGTGCATCATTCAGG - Intergenic
1053674194 9:40405724-40405746 CAAAGTAAAGGCTATCTTTCTGG + Intergenic
1053804421 9:41786382-41786404 CATTTTCAAGTGCATCATTCAGG - Intergenic
1053923997 9:43032091-43032113 CAAAGTAAAGGCTATCTTTCTGG + Intergenic
1054140862 9:61529080-61529102 CATTTTCAAGTGCATCATTCAGG + Intergenic
1054192729 9:61997874-61997896 CATTTTCAAGTGCATCATTCAGG - Intergenic
1054385301 9:64545792-64545814 CAAAGTAAAGGCTATCTTTCTGG + Intergenic
1054510427 9:65970566-65970588 CAAAGTAAAGGCTATCTTTCTGG - Intergenic
1054626069 9:67399694-67399716 CATTTTCAAGTGCATCATTCAGG + Intergenic
1054645676 9:67590817-67590839 CATTTTCAAGTGCATCATTCAGG + Intergenic
1056271043 9:84948464-84948486 CATTGTCACTGGCATCCTTCAGG - Exonic
1056994060 9:91438576-91438598 CATTGTCAAGGCTAATGTTCAGG + Intergenic
1061300161 9:129699723-129699745 CATGGTCCAGCCCAGCTTTCTGG + Intronic
1186546929 X:10459688-10459710 CATGGTCAAGGCCATCAACCAGG - Exonic
1186886665 X:13921210-13921232 CTTTCTGAAGGGCATCTTTCAGG - Intronic
1188614810 X:32144423-32144445 CATTATCAAGGCCATATTTTTGG + Intronic
1188757102 X:33975411-33975433 CATTCTCAAGCCAAACTTTCTGG + Intergenic
1189486149 X:41433843-41433865 GATTCTCAAGGCCATCTCTAAGG + Intergenic
1189698818 X:43695127-43695149 CATTTTCTAGGCCATATATCGGG - Intronic
1191191095 X:57668035-57668057 CCTTGTCAAATCCATATTTCTGG - Intergenic
1192279161 X:69665379-69665401 CATTGTCAAGGCCAACATCCAGG + Intronic
1196464616 X:115959310-115959332 CAGTGTGCAGGGCATCTTTCTGG + Intergenic
1197037500 X:121892911-121892933 CATTTTCAAGGACATTTTTAAGG - Intergenic
1197906034 X:131426836-131426858 CATTGTTTATGACATCTTTCAGG + Intergenic
1202051922 Y:20790417-20790439 CTTAGTCAATGCCATTTTTCGGG + Intergenic