ID: 988695275

View in Genome Browser
Species Human (GRCh38)
Location 5:33615638-33615660
Sequence TGGGGGTTTCAGCAATATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988695274_988695275 -8 Left 988695274 5:33615623-33615645 CCTTGCATTTTGTTATGGGGGTT 0: 1
1: 0
2: 1
3: 13
4: 144
Right 988695275 5:33615638-33615660 TGGGGGTTTCAGCAATATCTAGG 0: 1
1: 0
2: 1
3: 5
4: 108
988695269_988695275 13 Left 988695269 5:33615602-33615624 CCAGTGGGTGGTTTTAAAGCACC 0: 1
1: 0
2: 2
3: 9
4: 90
Right 988695275 5:33615638-33615660 TGGGGGTTTCAGCAATATCTAGG 0: 1
1: 0
2: 1
3: 5
4: 108
988695267_988695275 17 Left 988695267 5:33615598-33615620 CCTCCCAGTGGGTGGTTTTAAAG 0: 1
1: 0
2: 1
3: 9
4: 146
Right 988695275 5:33615638-33615660 TGGGGGTTTCAGCAATATCTAGG 0: 1
1: 0
2: 1
3: 5
4: 108
988695268_988695275 14 Left 988695268 5:33615601-33615623 CCCAGTGGGTGGTTTTAAAGCAC 0: 1
1: 0
2: 2
3: 8
4: 168
Right 988695275 5:33615638-33615660 TGGGGGTTTCAGCAATATCTAGG 0: 1
1: 0
2: 1
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988695275 Original CRISPR TGGGGGTTTCAGCAATATCT AGG Intronic
901957157 1:12794743-12794765 TGGGGGTTTCAGCTCTATTGGGG + Intronic
901965172 1:12860521-12860543 TGGGGGTTTCAGCTCTATTGGGG + Intronic
901980565 1:13030875-13030897 TGGGGGTTTCAGCTCTATTGGGG + Exonic
902001523 1:13198056-13198078 TGGGGGTTTCAGCTCTATTGGGG - Exonic
902020758 1:13343766-13343788 TGGGGGTTTCAGCTCTATTGGGG - Intronic
905645027 1:39619314-39619336 CAGGGCTTTCAGCAAAATCTGGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
908961908 1:69708348-69708370 AGGGGGTTTCAGTAATAGATGGG - Intronic
915768816 1:158396050-158396072 TGGGGGGTTGAGGAATAACTTGG + Intergenic
923328617 1:232902097-232902119 TGGCGGTTTCAAGAATAACTTGG + Intergenic
1064428895 10:15254625-15254647 TGGGAGTTTTAGCACTATGTGGG - Intronic
1066379857 10:34892025-34892047 TAGGGGTTTCAACATTAACTAGG + Intergenic
1068396694 10:56471217-56471239 TGGGGGTTCCAAAAATATATAGG - Intergenic
1070397109 10:76020718-76020740 TGGGGTCTTCAGCACCATCTTGG - Intronic
1072004716 10:91233326-91233348 TGGGGGTTTAAGCATGGTCTGGG - Intronic
1073906916 10:108292682-108292704 AGGGGGTTTCAGTCATATTTAGG - Intergenic
1074059669 10:109953473-109953495 TTGGGAATTCAGAAATATCTTGG + Intronic
1074470041 10:113718775-113718797 TGAGAGTTTTAACAATATCTGGG + Intronic
1080722622 11:34864965-34864987 TGAGGGTTTCAGCAATTTACTGG + Intronic
1085521879 11:77143898-77143920 TGAGGGCTGCAGGAATATCTGGG - Intronic
1086417813 11:86606571-86606593 TGGGGTTGTCAGAAATATTTTGG - Intronic
1087242581 11:95796691-95796713 TGGGGGTCTGAGCAACATCTGGG - Intronic
1087531877 11:99393248-99393270 TGGGTGTTGCAGCAATATACTGG + Intronic
1087707922 11:101516163-101516185 TGTGGATTTCAACAATACCTAGG + Intronic
1088114849 11:106302442-106302464 TGGGGCATTCAGGAATATGTAGG + Intergenic
1093101491 12:15034763-15034785 TGGGGGTATCAGAAATTACTTGG - Intergenic
1093346477 12:18042118-18042140 TGGGGGCTTCTGTAATATTTAGG + Intergenic
1095265972 12:40158158-40158180 TGTGGCTTTCAGAAAAATCTTGG + Intergenic
1101015079 12:100491722-100491744 TGTGGGTTCCAGGCATATCTGGG - Intronic
1108826092 13:54414378-54414400 GGTGGGTTTCAGCAATAATTCGG - Intergenic
1112119351 13:96392806-96392828 TGGTGGTTTGATCAATATCCTGG + Intronic
1113364185 13:109661236-109661258 TGGGGCTTCCCGCAATAGCTCGG + Intergenic
1115092251 14:29591810-29591832 TGGGGTTTTTAGCACTGTCTGGG + Intronic
1117195133 14:53332146-53332168 TAGAGGATTCAGCAACATCTGGG + Intergenic
1121418950 14:93798903-93798925 TGAGGGTTTCAGAAATAGCAAGG - Intergenic
1130987353 15:88853262-88853284 TGCTGATTTCAGCCATATCTGGG + Intronic
1131192021 15:90324510-90324532 TGGGTTTTTCAGAAATTTCTAGG + Intergenic
1131348025 15:91669255-91669277 TGTTGGCTACAGCAATATCTTGG - Intergenic
1135788427 16:25371597-25371619 TGGTGGTTTCAGGACTATCTAGG - Intergenic
1135958937 16:26979757-26979779 TGAGGGTGTCACCAAGATCTGGG + Intergenic
1147684998 17:42281836-42281858 TGGGGGATGCAGCATTATCCAGG + Intergenic
1150114273 17:62531619-62531641 GGGGGGTTTCTTCAAGATCTAGG + Intronic
1151135032 17:71938396-71938418 TGGGGCCTTCAGGAATATTTGGG - Intergenic
1155247610 18:23925005-23925027 TGGCAGTTTCAGGAATCTCTGGG - Intronic
1155980157 18:32171378-32171400 AGGAGGTTCCAGAAATATCTAGG - Intronic
1158662148 18:59397786-59397808 TGGCAGCATCAGCAATATCTGGG + Intergenic
1160010187 18:75101320-75101342 TGGTGGTCTGAGCTATATCTGGG + Intergenic
1165969092 19:39610390-39610412 TGGGGGCTTCAGCAATAACTGGG - Intergenic
937777202 2:125792183-125792205 TTGTGATTTCAGCAATGTCTTGG - Intergenic
938740326 2:134225277-134225299 TGGCAGTTTCAGCAACACCTGGG + Intronic
942541794 2:177022488-177022510 GAGGGGTTTCAGAATTATCTGGG + Intergenic
942814486 2:180035475-180035497 TGGGGATTTCACCTTTATCTGGG + Intergenic
945874957 2:215268196-215268218 TGGGGGTTGCAGCTTTAACTAGG - Intergenic
947387957 2:229611036-229611058 TGGGTTTTTCAGCAATTACTGGG + Intronic
1173668576 20:44781235-44781257 TGGGAGTTTCAGCAAGGTCTGGG - Intronic
1174978837 20:55368424-55368446 TGTGGGTTTCAGATATACCTAGG + Intergenic
1178986488 21:37308752-37308774 TCGGGGTTTCAGCCAAATGTGGG - Intergenic
1181077192 22:20388372-20388394 TGGGGGCTTCATCCATGTCTGGG - Intronic
1181337414 22:22149030-22149052 TGTGGGTTTCAGCAAAAGATAGG + Intergenic
1181584487 22:23845586-23845608 TGGGGGTATCAGAGATTTCTGGG + Intergenic
1182576966 22:31279378-31279400 TGGGAGTCTCAGCAATCTCTTGG + Intronic
1184798656 22:46747072-46747094 TGGGGGATTTGGCAATGTCTGGG - Intergenic
956889598 3:73598897-73598919 TGGGAGTTTCAGCAATCTGCAGG + Intronic
962968435 3:140375880-140375902 TGAGGGTTTTAGAAACATCTTGG + Intronic
969073695 4:4560317-4560339 TGTGGGTTTCAAAAATGTCTGGG - Intergenic
972893340 4:43587241-43587263 TGCGGGTTTCAGCTTTATCAGGG + Intergenic
975542318 4:75526790-75526812 TGGGGGTAGAAGCAATATTTAGG - Intronic
976151298 4:82095068-82095090 TGAAGGTTTCAGTAAGATCTAGG + Intergenic
980766566 4:137313936-137313958 GGTGGGTTTTATCAATATCTTGG - Intergenic
981102987 4:140850954-140850976 ATATGGTTTCAGCAATATCTAGG + Intergenic
984632299 4:182073783-182073805 TGGGCCTTTCAGCAACTTCTTGG + Intergenic
988695275 5:33615638-33615660 TGGGGGTTTCAGCAATATCTAGG + Intronic
990047216 5:51447818-51447840 TGGGGCTTACAGCAATATTCAGG - Intergenic
995499893 5:112793321-112793343 TGGGGGTTTCAGCATTCAGTAGG - Intronic
997081967 5:130749664-130749686 TTGAGGTTTTAGCATTATCTAGG + Intergenic
997810544 5:136963553-136963575 TGGGTGTTTAAGAAATATGTGGG + Intergenic
1005487063 6:26310758-26310780 TTGGGATTTTAGCAACATCTTGG - Intergenic
1007244694 6:40452353-40452375 TTGGGATGTCAGCAATATCACGG - Intronic
1008480241 6:51978263-51978285 TGGGGGTTTCAAAATTATATTGG + Intronic
1008896322 6:56560321-56560343 TGGGGGCCTCAGGAGTATCTGGG + Exonic
1008917104 6:56800113-56800135 TGGTGGTTACAGGCATATCTTGG - Intronic
1009684908 6:66944442-66944464 TGGGGAGTTAAGCAATAGCTAGG + Intergenic
1014974347 6:127860523-127860545 TGGGGGTTTAAGTATTATCCAGG + Intronic
1015288589 6:131511667-131511689 TGGGCCTTGCAGCAATGTCTAGG - Intergenic
1015354994 6:132267453-132267475 TTGGGGTTTCACCAACATGTTGG - Intergenic
1021232717 7:18105128-18105150 TGGGGATTTCATCTACATCTAGG + Intronic
1022351916 7:29574284-29574306 GGTGAGTTTCAGCAATATTTAGG + Intergenic
1025209104 7:57010553-57010575 TGGGGGATTCTGCCATATCAGGG + Intergenic
1030272847 7:107688154-107688176 TGGTGGATTCAACAATACCTAGG + Intronic
1032043977 7:128587394-128587416 GGGGGGTTTCTTCAAGATCTAGG + Intergenic
1032504363 7:132424476-132424498 TGGGGGTTCCACCAAGATTTTGG - Intronic
1043920917 8:85982372-85982394 AGCGAGTTCCAGCAATATCTTGG + Intergenic
1044845231 8:96373773-96373795 TGGTGGTCTCAGGAATTTCTTGG - Intergenic
1045748652 8:105455332-105455354 GGGGGGTTTGAGCAAAAACTGGG + Intronic
1048165577 8:132058913-132058935 TTGGGTTTTCAGCTATATCCTGG + Intronic
1048476602 8:134748017-134748039 CTGGGGTTTCAGAAATATCTGGG + Intergenic
1050213084 9:3286957-3286979 AGGAGTTTTCGGCAATATCTGGG - Intronic
1055101120 9:72466803-72466825 TTGGGGTTTCACAAATATGTTGG - Intergenic
1057453428 9:95186404-95186426 AGGGGATTTGAGCAATGTCTGGG - Intronic
1057474833 9:95389775-95389797 AGGGGATTTGAGCAATGTCTGGG + Intergenic
1059690203 9:116677428-116677450 TGGGGGTATCAGAAATTACTTGG + Intronic
1059991298 9:119868839-119868861 TGCTGGTTTCTGCATTATCTCGG - Intergenic
1061073427 9:128326122-128326144 GGGGGGATTCAGCAAGATCACGG - Intronic
1061358805 9:130127250-130127272 TGTGGCTGTTAGCAATATCTTGG + Intronic
1061884078 9:133582856-133582878 TGGGGTTTTCAGCCACATGTTGG + Intronic
1062350644 9:136137078-136137100 TGGGGGATTCAGCTTTATCCGGG - Intergenic
1185653691 X:1667454-1667476 TGGGGGCTTCAGACATTTCTGGG + Intergenic
1185909525 X:3969304-3969326 TGGGGGTTTCAGTAATTGGTTGG - Intergenic
1186664306 X:11702823-11702845 TGAGAGTGTCAGCAATCTCTTGG - Intergenic
1189281711 X:39823803-39823825 TGGGGGATTCAGCTATCTATTGG - Intergenic
1191797254 X:65034660-65034682 TGGGGTTTTGAGCACTTTCTAGG + Intronic
1194202484 X:90971285-90971307 TGGGGGTTTTAGCAATCATTTGG + Intergenic
1197234461 X:124043660-124043682 GGAAGGTTTCAGCAATATTTAGG + Intronic
1198235591 X:134733603-134733625 TGGGGGCCTCAGGAATAGCTAGG + Intronic
1200548321 Y:4546741-4546763 TGGGGGTTTTAGCAATCATTTGG + Intergenic