ID: 988698261

View in Genome Browser
Species Human (GRCh38)
Location 5:33646032-33646054
Sequence GTTCCAAGGAACCACTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988698261 Original CRISPR GTTCCAAGGAACCACTGTGC AGG Intronic
901241271 1:7695131-7695153 GCTCCAAAGCACCTCTGTGCAGG - Intronic
901587749 1:10312344-10312366 GGTCCAAGCCACCACAGTGCTGG + Intronic
904473621 1:30750881-30750903 GTCCCAAGCAGCCCCTGTGCAGG + Intronic
906707840 1:47907758-47907780 GGTCAAAGGAAACACTGTGAGGG - Intronic
906956318 1:50377808-50377830 GATCCTAGGAAGCACTGTGAGGG - Intergenic
912612665 1:111064161-111064183 GTTCCAAGGACTTACTGTGCTGG + Intergenic
917401809 1:174657954-174657976 GTTCCAGGGAACCACCATTCAGG + Intronic
918297803 1:183173710-183173732 GTTACAAGCAATCACTGTGAAGG + Intergenic
921520955 1:216153204-216153226 GTACCAAGAAAGCACTGAGCTGG + Intronic
924251462 1:242137334-242137356 GTTGCAAGGAAGCAGTGGGCAGG - Intronic
1062937566 10:1399738-1399760 GTGCCAGGGAACCACTGACCAGG + Intronic
1063165124 10:3454658-3454680 TTTTAAAGCAACCACTGTGCCGG - Intergenic
1063998847 10:11645941-11645963 GTTCCAAGCAATCACTGATCTGG + Intergenic
1069726441 10:70583148-70583170 GGTCCATGGAACTCCTGTGCGGG + Intergenic
1069876920 10:71568731-71568753 GTTCCCAGCCACCACTGAGCTGG + Intronic
1069937409 10:71927304-71927326 GCTCCCAGGATCCACTGAGCAGG + Intergenic
1071536590 10:86437994-86438016 GATCAATGTAACCACTGTGCGGG - Exonic
1071876917 10:89852374-89852396 GTGCCTAGGACCCACTGGGCTGG - Intergenic
1075242969 10:120794552-120794574 GTTCCAGGACACCACTGGGCTGG + Intergenic
1075546491 10:123358879-123358901 GTTTCAAGGAACCTTTGGGCTGG + Intergenic
1078406555 11:11075002-11075024 ATTCCAAACCACCACTGTGCGGG - Intergenic
1081491883 11:43575631-43575653 GTTCCACGCAGCCACTGAGCAGG - Intronic
1083547979 11:63563143-63563165 GTGGGAAGGAACCACGGTGCTGG - Intronic
1087300552 11:96428823-96428845 GTTCTTAAGAACCACTGTGTAGG + Intronic
1091082688 11:132686567-132686589 GTTCCAGAGAACCCATGTGCTGG - Intronic
1094831879 12:34304069-34304091 CTTCCCAGGAGCCACTGCGCGGG + Intergenic
1095714037 12:45322245-45322267 CTTCCAAGGAAGAACTGAGCTGG + Intronic
1097014370 12:55974561-55974583 CTTCCAATGAACCTCTCTGCAGG - Intronic
1098076196 12:66734329-66734351 GTTTCAAGGAAGCACAGTACAGG - Intronic
1105412631 13:20184188-20184210 GAGCCATGGAACCACTGTTCTGG - Intergenic
1111046478 13:82820467-82820489 GTTGCAGGGAACCACTGTGCTGG - Intergenic
1112285416 13:98099818-98099840 GTTGCAAGGAAGCAATGGGCAGG - Intergenic
1112746287 13:102530869-102530891 GTTTGAAGGAACCCCTGTCCAGG - Intergenic
1114711871 14:24786913-24786935 GTTTCAAGGAACCAATGTTGGGG - Intergenic
1115930419 14:38485526-38485548 GTACCAAGGTAACACTGGGCTGG - Intergenic
1117376717 14:55124267-55124289 GTTGCAAGGAAGCAATGGGCAGG + Intronic
1121128527 14:91424971-91424993 GTTGCAAGGAAGCAATGGGCAGG + Intergenic
1121945021 14:98111668-98111690 TGTCCCAGTAACCACTGTGCAGG + Intergenic
1123143482 14:106105857-106105879 AGTGCAAGGACCCACTGTGCAGG - Intergenic
1129694754 15:77734388-77734410 GTTCCAAGGACACTCTGTCCTGG - Intronic
1129909836 15:79217618-79217640 GTTCCAAAAAACCAGTGTACCGG + Intergenic
1131542124 15:93283355-93283377 GTTCCTAGGAAACACACTGCAGG + Intergenic
1132225117 15:100134295-100134317 GATCCCAGGAAGCACTGTGAGGG - Intronic
1138475110 16:57266066-57266088 GTTCCAAGGAAGCACGGATCTGG - Intronic
1138910925 16:61397798-61397820 GTTCCAAGGAACAACAGGGGAGG + Intergenic
1143353203 17:6304921-6304943 GTCCAAAGGCACTACTGTGCTGG + Intergenic
1143856336 17:9853365-9853387 GCTCCAGGGAACAGCTGTGCAGG + Intronic
1144824809 17:18099908-18099930 GTCCCAAGATACCTCTGTGCTGG - Intronic
1147538833 17:41339682-41339704 GTTCCAAGGCAGCAATATGCAGG + Intergenic
1147919159 17:43905976-43905998 ATGCCCAGGATCCACTGTGCTGG + Intronic
1151426736 17:74035574-74035596 ATCCCAAGGAACCACAGTGAAGG - Intergenic
1151677127 17:75604355-75604377 GTACCAAGCAAGCACCGTGCAGG - Intergenic
1152039629 17:77894474-77894496 GTTGCAAGGAAGCACAGTGTGGG + Intergenic
1153954297 18:10083224-10083246 GTTCTATGGAACAACTGGGCTGG + Intergenic
1162360990 19:10220370-10220392 CTTCAAAGGAGCCACTGAGCCGG + Intronic
1163135731 19:15309830-15309852 GTACCCAAGAATCACTGTGCCGG + Intronic
1163410707 19:17152439-17152461 GTTCCAACCAACCACTGTGGGGG + Intronic
1164879710 19:31721633-31721655 GTTCCAAGGCAGCTCAGTGCCGG + Intergenic
1165640532 19:37382029-37382051 GGTCAAAGGAACCAATGTGAAGG - Intronic
1167259891 19:48452502-48452524 GTTCCCAGCAACCCCTGGGCTGG + Intronic
1167817551 19:51897072-51897094 ATACCAAGGGACAACTGTGCAGG - Intronic
1168547350 19:57264325-57264347 CATCCAAGGGACCACTGTGTTGG + Intergenic
925018320 2:548255-548277 GTTCTAGGAAACTACTGTGCTGG + Intergenic
928240651 2:29582625-29582647 GTTCCTCGGAATGACTGTGCAGG - Intronic
929853645 2:45616223-45616245 GTTTCAAGCAAGCACTTTGCAGG - Intergenic
931354460 2:61522610-61522632 CTTCCAAGGAACCAGTGCGAAGG - Exonic
934493582 2:94779135-94779157 CTTCCAAGGTACAACTGTCCAGG + Intergenic
936463618 2:112728474-112728496 GTTCCAGGGAAGCCCTGAGCTGG - Intronic
941084990 2:161107199-161107221 TTTACAAGGAACTACGGTGCAGG + Intergenic
942758364 2:179368495-179368517 GTCCCAAGCAACCACTGATCTGG - Intergenic
945619702 2:212119656-212119678 CTACCAAGGAACCACATTGCTGG - Intronic
1170423962 20:16219797-16219819 TTACAAAGAAACCACTGTGCAGG - Intergenic
1170429896 20:16266295-16266317 GTTCTATGGGACCACTGGGCTGG + Intergenic
1172606518 20:36217754-36217776 GTACCAAGGAACCAGGCTGCTGG + Intronic
1172928927 20:38568158-38568180 GTTCTAAGGAATAACTATGCTGG - Intronic
1173147230 20:40535254-40535276 GTTGTTAGGAACCACTGTTCAGG - Intergenic
1178270268 21:31183085-31183107 TTTCCAAGGAACCAAAATGCAGG + Intronic
1184506794 22:44908525-44908547 GCTCCAAGCAACCCCTGGGCTGG + Intronic
950671035 3:14525546-14525568 GTTCCGAGGGATCACTGTGGTGG - Exonic
956186267 3:66565320-66565342 GTTGCAAGGAAGCAATGGGCAGG + Intergenic
963841675 3:150114188-150114210 GATCCCAGGAAACACTGTGAGGG - Intergenic
963852697 3:150224148-150224170 ATTCCCAGGAACCACTGGACTGG + Intergenic
967829011 3:193902792-193902814 GTTCAAAGGAAGGGCTGTGCTGG + Intergenic
969879867 4:10164031-10164053 GTTGCAAGAAACCGCTGGGCAGG + Intergenic
972138455 4:35924096-35924118 GTTTCAAGGATTCACTGTGGAGG - Intergenic
974214050 4:58821411-58821433 TTTCCAAGGAACTGCTGTGGAGG - Intergenic
975673616 4:76805346-76805368 GTACTCAGGAATCACTGTGCTGG + Intergenic
982015609 4:151150588-151150610 GGTCCAAGAAAGCAGTGTGCTGG + Intronic
982358455 4:154492968-154492990 GCTGCAAGAAACCACTATGCAGG - Intergenic
986724112 5:10581399-10581421 GTTCCTAGGAGCCACGGTGTTGG - Intronic
988355655 5:30170556-30170578 GTTCCAAGAACCAAATGTGCTGG - Intergenic
988698261 5:33646032-33646054 GTTCCAAGGAACCACTGTGCAGG + Intronic
993091803 5:83435362-83435384 GTTCCAGGGAAGCATTGTTCTGG - Intergenic
994703480 5:103168211-103168233 ATTTCAAGGAACCATTATGCTGG - Exonic
996658317 5:125967959-125967981 GTTCTATGGAACTACTGGGCAGG + Intergenic
998093412 5:139383736-139383758 GTCCCAAGTAACCCCTGTGCTGG + Intronic
999075702 5:148793291-148793313 GTCTCAAGGAACCACTGTGGGGG + Intergenic
1004305314 6:14496669-14496691 GTTCTAACTAACCTCTGTGCTGG + Intergenic
1007211670 6:40197437-40197459 CTTCTTAGGAACCACTGTGAGGG + Intergenic
1012755738 6:103228024-103228046 GTTAAAAGGAGCCAATGTGCAGG + Intergenic
1015897854 6:138034461-138034483 GTTCAGAGGCACCACTGAGCCGG - Intergenic
1017016678 6:150106612-150106634 GTCCCAAGGAATAACTGTGTGGG - Intergenic
1019862405 7:3671967-3671989 GCTCCAAGCAACTACTGTGTAGG - Intronic
1021118540 7:16771312-16771334 GTTCCAAGAACCCTCTGTGGTGG + Intronic
1022334141 7:29406710-29406732 GTTCCCAGGAGCCACTGTGTGGG + Intronic
1025927899 7:65973949-65973971 GCACCCATGAACCACTGTGCTGG - Intronic
1027552007 7:79610492-79610514 GTTCCTAGGAGACACAGTGCAGG + Intergenic
1029008001 7:97230433-97230455 GTACCAAGGAGTCACTGAGCTGG + Intergenic
1030987545 7:116260275-116260297 ATGCAAAGGACCCACTGTGCTGG + Intergenic
1032432197 7:131871272-131871294 GATCCCAGGAAACACTGTGCTGG - Intergenic
1033422806 7:141218210-141218232 TGTGCAAGGATCCACTGTGCTGG - Intronic
1034038801 7:147854623-147854645 GTGGCTAGGAACCACTGTGCTGG - Intronic
1034725387 7:153330931-153330953 GTTCAAGGGAGCCACTGTGTGGG - Intergenic
1035132568 7:156669460-156669482 GTTCCCTGGAACCTCTGTCCAGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1041156895 8:54996728-54996750 GTTCCCAACTACCACTGTGCTGG - Intergenic
1041544934 8:59032480-59032502 GTTCCAAGGCACCAGACTGCGGG - Intronic
1041656413 8:60355183-60355205 CTTCCAGGGAACCACTGGACAGG - Intergenic
1042196782 8:66237908-66237930 GTTCCAAGGAGGCACTGGGGTGG + Intergenic
1043178821 8:77057805-77057827 GCTGCCAGGAAGCACTGTGCTGG + Intergenic
1055711052 9:79062508-79062530 GTTCCAAGGAGCCAGTGTGAGGG + Intergenic
1057140787 9:92725727-92725749 GTTTCAAGGAGCCACTGTGCAGG + Intronic
1057202636 9:93150901-93150923 GTCAAAAGGAACCTCTGTGCTGG - Intergenic
1060375001 9:123109623-123109645 GTGCGAAGGAGCCACAGTGCGGG + Intronic
1061711265 9:132489647-132489669 GTTCTAAGGGATCCCTGTGCAGG + Intronic
1061764263 9:132871514-132871536 GGTCCCAGGAACCACTGTTTTGG - Intronic
1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG + Intergenic
1188261535 X:28030541-28030563 TTTCCAAGGCACCACTGTGCTGG + Intergenic
1191250758 X:58259117-58259139 CTTCCCAGGAGCCCCTGTGCTGG + Intergenic
1191252446 X:58266020-58266042 CTTCCCAGCAGCCACTGTGCAGG - Intergenic
1197616589 X:128698774-128698796 ATTTCAAGGATTCACTGTGCTGG + Intergenic