ID: 988699036

View in Genome Browser
Species Human (GRCh38)
Location 5:33654609-33654631
Sequence ACTAAGACTTTGATCCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988699036_988699040 13 Left 988699036 5:33654609-33654631 CCTGTAGGGATCAAAGTCTTAGT 0: 1
1: 0
2: 0
3: 2
4: 78
Right 988699040 5:33654645-33654667 TTTTGACACTACCCAAGTAGTGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988699036 Original CRISPR ACTAAGACTTTGATCCCTAC AGG (reversed) Intronic
906808901 1:48806530-48806552 TCAATGACTTTGATCCCTGCAGG - Intronic
917204727 1:172560657-172560679 ACTATGACTGTGATCCCTGAAGG + Intronic
917399172 1:174627625-174627647 AAAAAGACATTGATCTCTACTGG - Intronic
917925986 1:179789476-179789498 AATAAGAATCTGATCCCTGCCGG - Intronic
922861901 1:228826117-228826139 GCTAAGACTTGAATCCCCACTGG - Intergenic
1064121248 10:12622084-12622106 ACTGAGACTTTTGTCCCTAATGG - Intronic
1065406999 10:25379490-25379512 ACTAGGACCTTTATCCATACAGG + Intronic
1068825092 10:61428229-61428251 ACTGAGACTTAAATCCCTAATGG + Intronic
1069107858 10:64405649-64405671 TCTAAGACTTTGACCCCCAAAGG - Intergenic
1072063147 10:91837414-91837436 ACTAAGCCCTGGATCCCTAGAGG - Intronic
1074807851 10:117072002-117072024 TCTAAGACTTTGTTCCTGACAGG + Intronic
1077613729 11:3660551-3660573 ACTATGGCTTAGATCCCTTCAGG - Intronic
1077829167 11:5845614-5845636 ACTAAAACTTTGATTCCTTTGGG + Intronic
1078769586 11:14336074-14336096 GCTAAGACTTTCATCCCAACTGG + Intronic
1082091562 11:48094621-48094643 ACTTAGACTCTGATCTCTATTGG + Intronic
1085352992 11:75812571-75812593 ACTAGGACTCTCATCCCTAGGGG - Intergenic
1088677880 11:112213884-112213906 ACTAAGACTTTGAACTTTAATGG + Intronic
1091805872 12:3355405-3355427 CCTCAGCCTTTGATCCCCACTGG - Intergenic
1095054859 12:37586625-37586647 ATTAAGACAATGATCCTTACAGG - Intergenic
1110519161 13:76455042-76455064 CCTAAGACTTTGTTCTCAACTGG + Intergenic
1121475207 14:94194125-94194147 ACTAATTATTTTATCCCTACTGG - Intronic
1124075085 15:26436708-26436730 TCTAAAACTTTGTTCCTTACTGG + Intergenic
1127072603 15:55301010-55301032 ACTCAGACTTTGATGGCCACTGG + Intronic
1127396212 15:58545886-58545908 ACTATGACTTCTATCCCAACGGG + Exonic
1127732790 15:61815878-61815900 ACCAGGACTTTGTTCCCTAAGGG - Intergenic
1130768878 15:86903949-86903971 GCCAAGACTTTTATCCCCACTGG - Intronic
1136001036 16:27292886-27292908 CCTGAGACTTTCATCCGTACTGG + Intergenic
1145375536 17:22344206-22344228 ATTAAGACAATGATCCTTACAGG - Intergenic
1149810151 17:59661325-59661347 CCTAAGAGATTGATCTCTACAGG + Intronic
1155612193 18:27678602-27678624 GCTAAGACTCTCATCCCTTCTGG + Intergenic
1156584905 18:38421234-38421256 ACTCTGTCTTTGATCCCTGCTGG - Intergenic
1162247928 19:9418118-9418140 ACTAAGACTTTTATCCAAATAGG + Intronic
1167568320 19:50271251-50271273 AATAAGAGTTTGATCCTTCCCGG + Intronic
1168494551 19:56838553-56838575 ACCAAGACTTTGTTCACCACAGG - Intronic
928368999 2:30725604-30725626 ACAAAGACTTTGCTCGCTCCAGG + Intronic
929090366 2:38210689-38210711 ACTAGGACTTTCATCCCAGCTGG + Intergenic
936906969 2:117548065-117548087 ACTAATGCTGTGATGCCTACAGG + Intergenic
937063174 2:118995244-118995266 ACGAAGCCTTTTATACCTACAGG - Intergenic
937686349 2:124702137-124702159 ACCAAGGCTTTGATCCATTCAGG + Intronic
939334309 2:140805686-140805708 ACTAATAGTTTGATCACTAATGG + Intronic
943930599 2:193846967-193846989 AATTAGGCTTTGATCCATACTGG + Intergenic
1170641059 20:18153095-18153117 ACAAAGTCTTTGATCACTTCAGG + Intronic
1171527398 20:25825666-25825688 ATTAAGACAATGATCCTTACAGG + Intronic
1171549428 20:26030218-26030240 ATTAAGACAATGATCCTTACAGG - Intergenic
1172671173 20:36635375-36635397 TCTAAGACCTTGCTTCCTACAGG - Intronic
951613601 3:24519548-24519570 AGCAAGACTGTCATCCCTACTGG - Intergenic
959615843 3:108346200-108346222 ACTGAAACTTTGATCTCTAGGGG - Intronic
959833912 3:110896288-110896310 ACTAAAGCTCTGCTCCCTACAGG + Intergenic
966814169 3:183875798-183875820 TCTAAGACTTTCATAGCTACAGG + Intronic
973010977 4:45072476-45072498 ACTGAGACTCTGATGCCAACAGG - Intergenic
975223234 4:71838561-71838583 ACTAAGACATTGAACCCTGTGGG + Intergenic
976368327 4:84257062-84257084 AATAAGATTTTGATCCCAGCAGG + Intergenic
983415876 4:167453613-167453635 ACTAAAACCTTGATCTCTTCGGG + Intergenic
988699036 5:33654609-33654631 ACTAAGACTTTGATCCCTACAGG - Intronic
990574970 5:57115440-57115462 AATAAGTCTTTCATTCCTACTGG + Intergenic
992065454 5:73103558-73103580 ACTAAGGCTTTCTTCCCTAAAGG + Intergenic
993476301 5:88369620-88369642 GCTAAGACTTTGATACATGCAGG - Intergenic
993598080 5:89884697-89884719 ATTAAAACATTAATCCCTACAGG + Intergenic
995234717 5:109814907-109814929 ACTAAGCCTAGAATCCCTACTGG - Intronic
995260113 5:110093833-110093855 ACTAGGTCTTTGATACCTAAAGG - Intergenic
999562514 5:152820117-152820139 ACTGAAACTTTTATCCCTGCTGG + Intergenic
1007021094 6:38522201-38522223 GCTAAGGCTTTGTTCTCTACTGG + Intronic
1014751559 6:125262562-125262584 TCTAAGATTTTAATCCCTTCAGG - Intronic
1015627954 6:135201115-135201137 GCTAAAACTTTGATCCTTGCAGG - Intronic
1017355777 6:153506076-153506098 GCCAGGACTTTTATCCCTACTGG + Intergenic
1021906049 7:25334625-25334647 ACAAAGAATATGCTCCCTACAGG - Intergenic
1025298251 7:57794211-57794233 ATTAAGACAATGATCCTTACAGG - Intergenic
1033813928 7:145050358-145050380 TCTAAGTCTTTGCTCACTACAGG + Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1035830067 8:2686290-2686312 ACTCAGACTTTAATCCTTGCAGG + Intergenic
1042589008 8:70377082-70377104 ACTAAGACTATGATCAACACAGG + Intronic
1044511029 8:93079161-93079183 ACCAAGATTTTTATCCCTTCTGG - Intergenic
1044888998 8:96812509-96812531 ACTAATATTTTGATCCCTCAAGG - Intronic
1046670718 8:117053281-117053303 ACTAAGATTTTTTTCCCTTCAGG + Intronic
1048924919 8:139262808-139262830 GCCAAGACTTTCATCCCCACTGG + Intergenic
1055841411 9:80509301-80509323 AATAACACTTTGATATCTACAGG + Intergenic
1058103132 9:100938371-100938393 ACCATGACTTTGACCTCTACTGG + Intergenic
1190932823 X:54964047-54964069 ACTAAGACTTTTTTCCCTTTGGG - Intronic
1192876156 X:75231771-75231793 AATAAGACCTGGATCCCTTCTGG - Intergenic
1198851677 X:140970873-140970895 AGTAAGACTTCGAGACCTACTGG + Intergenic
1201911568 Y:19138329-19138351 ACTAGGACTTTTATCCCTGCAGG - Intergenic