ID: 988704747

View in Genome Browser
Species Human (GRCh38)
Location 5:33714003-33714025
Sequence CAAGCCCACATGAAGATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988704747_988704749 8 Left 988704747 5:33714003-33714025 CCTGAAATCTTCATGTGGGCTTG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 988704749 5:33714034-33714056 CTTGTATTTATTTGAAAGTCTGG 0: 1
1: 0
2: 2
3: 29
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988704747 Original CRISPR CAAGCCCACATGAAGATTTC AGG (reversed) Intronic
904855907 1:33498161-33498183 CAGGGCTACATGAAGAATTCAGG - Intergenic
904908385 1:33915232-33915254 TAAGCATACATTAAGATTTCAGG - Intronic
905003166 1:34689292-34689314 CAAGCCCAAATGATGACTTTGGG + Intergenic
905354511 1:37372095-37372117 AAGTCCCACATCAAGATTTCTGG + Intergenic
906542738 1:46600501-46600523 CAAGCCCACATGAGTATTAGCGG - Intronic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
909105005 1:71396386-71396408 GAATGCCACATGAACATTTCAGG + Exonic
909635094 1:77808717-77808739 CAAGGCCACATCAAGTTTACTGG - Intronic
912796588 1:112697118-112697140 CAGTCCCAGATGAAGTTTTCAGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG + Intronic
921982495 1:221273724-221273746 CAAGCACACATTAAGGGTTCAGG - Intergenic
1063078016 10:2735895-2735917 CAACCCCACAGGATGATTCCAGG + Intergenic
1068798291 10:61109061-61109083 CAAGGCCACGTGACTATTTCTGG + Intergenic
1069252128 10:66281594-66281616 CTTGCCCATATGAAGATGTCGGG + Intronic
1071402033 10:85282848-85282870 CATCCCCACATGAACAGTTCTGG + Intergenic
1074188975 10:111119444-111119466 CAAGTCCACATGCAGTTTTCTGG - Intergenic
1075116287 10:119629857-119629879 AAAGCCAACATGAACGTTTCAGG - Intergenic
1076551942 10:131285681-131285703 CAATTCAACATGAAGATTTTGGG + Intronic
1080654798 11:34250356-34250378 CCAGCACCCATGAAGATGTCTGG + Intronic
1083518088 11:63279160-63279182 CAAGTCCACATGGAGATCTACGG - Intronic
1086900228 11:92359113-92359135 AAAGCCTAAATGAAGATTCCCGG - Intronic
1087998613 11:104845793-104845815 AAAGGACACAAGAAGATTTCGGG - Intergenic
1088319351 11:108539307-108539329 CAACCTCACATGAAGACCTCAGG + Intronic
1088898789 11:114098910-114098932 CAAGCAAATATGAAGAATTCTGG - Intronic
1091352732 11:134910353-134910375 CAAGGCCACATGAAAATATTTGG + Intergenic
1093770964 12:23018257-23018279 CTGGCCCAAATGAAAATTTCTGG + Intergenic
1099864125 12:88257436-88257458 CATGCCCAGAGGAAGTTTTCAGG + Intergenic
1103271889 12:119680313-119680335 CAAGCCCATATGAAGAGCTGGGG + Exonic
1104438972 12:128779619-128779641 AAAGCCTACATGTGGATTTCAGG - Intergenic
1114536178 14:23424355-23424377 GAGGTCCAGATGAAGATTTCTGG - Intronic
1116152711 14:41162220-41162242 AAACCACACATGAAAATTTCTGG - Intergenic
1117200289 14:53383138-53383160 AAAACCCACATGCAAATTTCAGG + Intergenic
1117332327 14:54725249-54725271 CAAGCTCTCATGAAGAGTTCTGG + Intronic
1117592222 14:57282744-57282766 CAAGCACACATAAACATTTTTGG - Intronic
1118844686 14:69538514-69538536 GAAGCCCACTGGAAGACTTCTGG + Intergenic
1121493193 14:94374630-94374652 CTAGGCCAGAGGAAGATTTCTGG + Intergenic
1122022848 14:98853773-98853795 GAAGCCCACATGGAGCTTTTGGG + Intergenic
1122610165 14:102976939-102976961 CCAGCCCACAGGAGGCTTTCTGG - Intronic
1131322963 15:91413639-91413661 CCAGCACACATGAAGGGTTCAGG - Intergenic
1134693562 16:16206744-16206766 CCAGCCAACATGAAAATTACAGG - Intronic
1134978289 16:18587956-18587978 CCAGCCAACATGAAAATTACAGG + Intergenic
1140927414 16:79598123-79598145 CAATCTCACATGAAGAACTCAGG + Intronic
1141308512 16:82890161-82890183 CAAGCCTACATCAAAATTCCAGG - Intronic
1143896363 17:10139724-10139746 GTAGACCACAGGAAGATTTCTGG + Intronic
1143999334 17:11038046-11038068 TAAGCCCACAGGATGATTCCTGG + Intergenic
1156449063 18:37256276-37256298 CATGCCCTCATGAAGGTATCTGG + Intronic
1157209004 18:45725244-45725266 CAAGGCAATATCAAGATTTCAGG - Intronic
1158957518 18:62554378-62554400 CAACCCCAAATGCACATTTCAGG - Intronic
1164823786 19:31269297-31269319 CAAGCCCTGATGAGGCTTTCAGG + Intergenic
927165032 2:20310291-20310313 AAAGTCCACATTAATATTTCAGG + Intronic
929413596 2:41724720-41724742 AAAGACCACATGAGGATTTATGG + Intergenic
929758378 2:44786557-44786579 GAGGCCCACAGGAAGATTTCAGG + Intergenic
932474141 2:71990741-71990763 CAATCCCACTGGAAGCTTTCAGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
937141939 2:119609519-119609541 GAAGACCACATGAAGATATGAGG - Intronic
938701364 2:133883052-133883074 CAATCCCAAATGGAAATTTCTGG + Intergenic
938984593 2:136561838-136561860 CATTCCCACAAGAAGAATTCTGG + Intergenic
940465050 2:154016737-154016759 CAAGCCAACAGGATGATTTGAGG + Intronic
941064781 2:160889718-160889740 CAAGCCCAGATGAAAATTAAAGG + Intergenic
941291053 2:163675603-163675625 CATGCGCACATGCAGATATCTGG - Intronic
943991952 2:194707455-194707477 TAAGCCCACATTAACATTGCAGG + Intergenic
1169079707 20:2789535-2789557 CAACAACAGATGAAGATTTCTGG + Intergenic
1171142767 20:22757415-22757437 GAAGACCACCTCAAGATTTCAGG + Intergenic
1172052208 20:32126644-32126666 CATGCCCACAAGGAGCTTTCAGG - Intronic
1173172747 20:40740939-40740961 CAAGCCCACATGCACATCTCGGG - Intergenic
1175496468 20:59417998-59418020 CAACACCACTTGTAGATTTCAGG + Intergenic
1177660296 21:24074048-24074070 CAATACCACCTGAAGATTTTTGG - Intergenic
1178088003 21:29132244-29132266 CAAAAACACATGAATATTTCTGG - Intronic
1179284382 21:39964192-39964214 CCAGCCCACAGGAAGGTCTCAGG - Intergenic
1181628827 22:24139801-24139823 GATGCCCACATGAATATTTGTGG + Intronic
1181774888 22:25152290-25152312 CAAGCCCATATGCAGTTTTAAGG + Intronic
1184870937 22:47238124-47238146 CAAGCCCTCATGAAGATGAAGGG + Intergenic
950754495 3:15161962-15161984 CAATCCCCCAGGAAGAATTCAGG - Intergenic
951147357 3:19243755-19243777 CAAGCATACATGAAGATTTGAGG - Intronic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
953197578 3:40748857-40748879 TAAAGCCACATGAAAATTTCAGG - Intergenic
955538991 3:59954131-59954153 CAAGTGCCCATGAAGGTTTCTGG - Intronic
965171346 3:165268536-165268558 CAAGCCAACAGGTAGATTTGTGG + Intergenic
967535027 3:190592274-190592296 GAAGCCCACATAATGAATTCTGG - Intronic
969457038 4:7306149-7306171 CAAGCCCACATGCAGCTGTCTGG - Intronic
972901307 4:43687545-43687567 TAAGCAAACATGAAGATTTTAGG - Intergenic
973195400 4:47433976-47433998 CAAGCATGCATGAAGAATTCCGG + Intergenic
973659749 4:53091721-53091743 CAGGCAGACATGAAGATTTCTGG + Intronic
974689493 4:65277887-65277909 CAAGTCGAAATGAGGATTTCAGG + Intergenic
979007601 4:115321780-115321802 CAAGCCAACATATAGATTTATGG - Intergenic
980437487 4:132796833-132796855 CAAGCCAACATAAAGAATTTAGG - Intergenic
981425525 4:144598086-144598108 CAAGTTCACTTGAAGATTTCAGG - Intergenic
982982046 4:162150352-162150374 CAAGCTGACATCAAGGTTTCTGG - Intronic
984263145 4:177465749-177465771 CACGCCCAGATGACTATTTCTGG - Intergenic
986057468 5:4153024-4153046 AAAGACTAAATGAAGATTTCTGG - Intergenic
988704747 5:33714003-33714025 CAAGCCCACATGAAGATTTCAGG - Intronic
996171433 5:120296631-120296653 CATGCCTTCGTGAAGATTTCTGG + Intergenic
1000109292 5:158092595-158092617 CAAGGCCACATTAAACTTTCAGG - Intergenic
1001017348 5:168153550-168153572 AAAGCCCACAAGAAGAATCCAGG + Intronic
1002850767 6:994964-994986 CCACCCCACAGGAAGATCTCTGG + Intergenic
1004670252 6:17789116-17789138 CAAACCAAGATGAAGCTTTCTGG - Intronic
1006792765 6:36714564-36714586 CAAGCGCAAATGCAGATTCCTGG - Intronic
1008231159 6:48986430-48986452 CAACCCAACATGAAGTTTTCTGG + Intergenic
1010495784 6:76532724-76532746 GAAGCCCAGATGAAGCATTCAGG + Intergenic
1015559760 6:134501978-134502000 CGAGCCCCCATGAACATTTTTGG + Intergenic
1016552340 6:145295874-145295896 CAAGCCCACAGGCAGTTTGCTGG + Intergenic
1016722840 6:147322809-147322831 CAAGTACACTTGAAGTTTTCTGG + Intronic
1017520437 6:155197116-155197138 CAAGCCCACTGGGAGACTTCTGG - Intronic
1018042964 6:159941256-159941278 CAAGTCTGGATGAAGATTTCTGG - Intergenic
1019289769 7:244749-244771 CAAGGCCAGATGAGGATTCCAGG - Intronic
1019330577 7:458671-458693 CAAGCCCACAGGAAGCCTCCGGG - Intergenic
1022552329 7:31252664-31252686 CAAGCCAACATCATGAGTTCAGG + Intergenic
1022857792 7:34332676-34332698 CAAGCCAGCATGTAGATTTGGGG + Intergenic
1030794095 7:113766003-113766025 CATACCCAAAAGAAGATTTCAGG + Intergenic
1031675651 7:124609173-124609195 CAAGTCCACATGCATTTTTCAGG + Intergenic
1033092532 7:138399457-138399479 CCAGCCCACATGAATTTTGCAGG + Intergenic
1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG + Intergenic
1042214280 8:66413974-66413996 CAAGTCCACATGATTAGTTCTGG + Intergenic
1043952662 8:86326518-86326540 CAAATCCACATGAAAATTTGAGG + Intergenic
1044493201 8:92845269-92845291 CAAGCCTAAAGGGAGATTTCAGG - Intergenic
1047432301 8:124803556-124803578 CAAGCACACATAAAAATTACTGG - Intergenic
1048007901 8:130433909-130433931 CAAGGCCACATGAAGAATTAAGG + Intronic
1048509940 8:135053216-135053238 CAAGCACAGATGAAAATATCTGG + Intergenic
1049499708 8:142955309-142955331 CAAGGCCACAGGATGACTTCAGG + Intergenic
1051880823 9:21838036-21838058 CAAGCCCACATGATTTATTCTGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054925256 9:70582342-70582364 CAAGCAAACAAAAAGATTTCAGG - Intronic
1056278538 9:85017110-85017132 TAAGGCCAAATGAAGAGTTCAGG + Intronic
1056497909 9:87178215-87178237 AAAGACCAGATGCAGATTTCTGG + Intergenic
1060303104 9:122387579-122387601 GAAGGCCACATGAAGATGTAGGG + Intronic
1187627893 X:21137400-21137422 CAAGCACACATGAAAAATTGGGG - Intergenic
1190142281 X:47858351-47858373 CATTCCCAAATGAAGAGTTCTGG - Intronic
1194691019 X:96984755-96984777 CCAGCTCACATGTATATTTCTGG - Intronic
1195707757 X:107750384-107750406 TGAGCCCACCTGAAGATGTCTGG - Intronic
1195996275 X:110734745-110734767 CAAGTTCACATGAAGATTTGAGG - Intronic
1196250633 X:113456031-113456053 CAAGACACCATGAGGATTTCAGG - Intergenic
1196802318 X:119554804-119554826 CCAGCCCTAATCAAGATTTCAGG + Intronic
1197849919 X:130846761-130846783 CAAGTCCACATGAAGGTTGATGG - Intronic
1198219554 X:134586992-134587014 CCAGCCCACATTAACATTTATGG + Intronic
1199609581 X:149601161-149601183 CAAGCCCAGAGGACGAGTTCCGG + Intronic
1199629535 X:149768193-149768215 CAAGCCCAGAGGACGAGTTCCGG - Intergenic
1200282721 X:154791782-154791804 CATGCCACCATGAAGAATTCTGG + Exonic