ID: 988705537

View in Genome Browser
Species Human (GRCh38)
Location 5:33722958-33722980
Sequence CTGCTTTTCTTGGGCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 381}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988705537_988705551 30 Left 988705537 5:33722958-33722980 CCCTGGAAGCCCAAGAAAAGCAG 0: 1
1: 0
2: 3
3: 26
4: 381
Right 988705551 5:33723011-33723033 CAGTGGCAGTTCAGGATCAGGGG No data
988705537_988705545 -1 Left 988705537 5:33722958-33722980 CCCTGGAAGCCCAAGAAAAGCAG 0: 1
1: 0
2: 3
3: 26
4: 381
Right 988705545 5:33722980-33723002 GAGAGAGTGGGTATGAGGATGGG No data
988705537_988705544 -2 Left 988705537 5:33722958-33722980 CCCTGGAAGCCCAAGAAAAGCAG 0: 1
1: 0
2: 3
3: 26
4: 381
Right 988705544 5:33722979-33723001 AGAGAGAGTGGGTATGAGGATGG 0: 1
1: 1
2: 2
3: 86
4: 1149
988705537_988705549 28 Left 988705537 5:33722958-33722980 CCCTGGAAGCCCAAGAAAAGCAG 0: 1
1: 0
2: 3
3: 26
4: 381
Right 988705549 5:33723009-33723031 GACAGTGGCAGTTCAGGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
988705537_988705548 22 Left 988705537 5:33722958-33722980 CCCTGGAAGCCCAAGAAAAGCAG 0: 1
1: 0
2: 3
3: 26
4: 381
Right 988705548 5:33723003-33723025 GAAGATGACAGTGGCAGTTCAGG 0: 1
1: 0
2: 0
3: 21
4: 228
988705537_988705546 0 Left 988705537 5:33722958-33722980 CCCTGGAAGCCCAAGAAAAGCAG 0: 1
1: 0
2: 3
3: 26
4: 381
Right 988705546 5:33722981-33723003 AGAGAGTGGGTATGAGGATGGGG 0: 1
1: 0
2: 2
3: 42
4: 557
988705537_988705550 29 Left 988705537 5:33722958-33722980 CCCTGGAAGCCCAAGAAAAGCAG 0: 1
1: 0
2: 3
3: 26
4: 381
Right 988705550 5:33723010-33723032 ACAGTGGCAGTTCAGGATCAGGG 0: 1
1: 0
2: 3
3: 19
4: 206
988705537_988705543 -6 Left 988705537 5:33722958-33722980 CCCTGGAAGCCCAAGAAAAGCAG 0: 1
1: 0
2: 3
3: 26
4: 381
Right 988705543 5:33722975-33722997 AAGCAGAGAGAGTGGGTATGAGG 0: 1
1: 2
2: 2
3: 52
4: 516
988705537_988705547 13 Left 988705537 5:33722958-33722980 CCCTGGAAGCCCAAGAAAAGCAG 0: 1
1: 0
2: 3
3: 26
4: 381
Right 988705547 5:33722994-33723016 GAGGATGGGGAAGATGACAGTGG 0: 1
1: 0
2: 4
3: 75
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988705537 Original CRISPR CTGCTTTTCTTGGGCTTCCA GGG (reversed) Intronic
902310929 1:15581102-15581124 CTGCTTGTCTTGGCCTCCCAAGG - Intronic
902670777 1:17971799-17971821 CTGCTTTCCCTGGTCTTCCTGGG - Intergenic
902819456 1:18935083-18935105 CTGCTTTTCCTTGGCTCCCTGGG - Intronic
903342052 1:22660800-22660822 CTGCTTTTCCAGGGCTTCCAGGG + Exonic
903580488 1:24367031-24367053 CTGCGTGTCTGGGGCTTCTAGGG - Intronic
904290834 1:29485036-29485058 CTGCTTTTCCAGAGCTTACATGG - Intergenic
907421956 1:54353628-54353650 CTGTTTTTCTCTGACTTCCATGG - Intronic
907990188 1:59573851-59573873 CTGAGTTTCCTTGGCTTCCAGGG - Intronic
908282981 1:62562456-62562478 CTGCTTGCCTTGGCCTCCCAAGG + Intronic
908329228 1:63054284-63054306 CTGCTTGCCTTGGCCTCCCAAGG + Intergenic
908450624 1:64251556-64251578 CTGCTTTTCTTTGCTCTCCATGG - Intronic
908769497 1:67583272-67583294 TTCCCTTTCTTGTGCTTCCAAGG - Intergenic
909040651 1:70645747-70645769 CTCCTTTTCTTGAGCCTTCATGG - Intergenic
909366885 1:74835136-74835158 TTGTTTATCTTGGGCTCCCAGGG - Intergenic
910186099 1:84542212-84542234 CTGCATTTCTTGGGAGGCCAAGG - Intergenic
910722751 1:90304726-90304748 CAGGTTTTCTTGAGCTTCCCAGG + Intergenic
910913346 1:92261319-92261341 GTACTTTTCTTGGTTTTCCATGG + Intronic
911171131 1:94772185-94772207 CTGCATCTCTTGGGCTTAAATGG - Intergenic
912048181 1:105487472-105487494 ATACTTTTCCTGGACTTCCAAGG - Intergenic
914723408 1:150307817-150307839 CTGCTCACCTTGGGCTCCCAGGG + Intronic
915504822 1:156347551-156347573 CTGCTCATCTTTGCCTTCCATGG - Intronic
915982070 1:160426467-160426489 CTCGTTTCCTTGGCCTTCCAGGG + Exonic
916364515 1:164009482-164009504 CAGCTTTACTTGTGCTTCCCTGG + Intergenic
916500184 1:165380465-165380487 TTGTTTTTCTTGGCATTCCAGGG - Intergenic
918239252 1:182607371-182607393 CTGCTTTTCACTGGCTACCATGG - Intergenic
918374464 1:183895292-183895314 ATGCTGTTCTTGGGCTTCAGAGG - Intronic
918681958 1:187367051-187367073 CTGCCTGTCTTGGCCTCCCAAGG + Intergenic
918835692 1:189462100-189462122 AGGCTTTTCTTGGACTCCCATGG - Intergenic
919008487 1:191929436-191929458 CAGCATTTCTGGGCCTTCCATGG + Intergenic
919310519 1:195901121-195901143 TTGCTTTTATTTGGCTTCCATGG - Intergenic
920105058 1:203546676-203546698 ATGCCTCTCTTGGGCTTTCATGG - Intergenic
920460406 1:206135316-206135338 CTCCCTTTCCTGGGCATCCAGGG - Intergenic
920745530 1:208624437-208624459 CTGCTTTCCCTGGTGTTCCATGG + Intergenic
920883358 1:209900489-209900511 CTGCTCCTCTTCAGCTTCCAGGG + Intergenic
921542855 1:216438506-216438528 ATGCTTTTCTTGGACTTACTTGG + Intergenic
922237583 1:223733598-223733620 CTGCCTTTCTTGGGGACCCACGG - Intronic
924529663 1:244882521-244882543 CTGCCTGCCTTGGCCTTCCAAGG - Intergenic
1062835627 10:633746-633768 TTGCATTTCTTGTGCTTCAATGG - Intronic
1065024143 10:21525810-21525832 CTGCTTTTCCTGGGCTGCTGGGG - Intergenic
1065321421 10:24513606-24513628 CTGAATTTCCTGGGCCTCCATGG - Intronic
1065416338 10:25491049-25491071 ATGCTTTTATTTGGTTTCCAAGG - Intronic
1065612485 10:27485879-27485901 CTGATTTTCCTTGGGTTCCATGG + Intergenic
1065759108 10:28965188-28965210 ATCCTTTTCTTAGACTTCCAGGG - Intergenic
1065776135 10:29121884-29121906 CTGTTTTTCTGGCTCTTCCAGGG - Intergenic
1069153940 10:65001089-65001111 CTGCTTGCCTTGGCCTCCCAAGG + Intergenic
1069201154 10:65618336-65618358 CTGCTATTTTTGTGCTACCATGG + Intergenic
1069390874 10:67933209-67933231 CTTCTTTTCCTTGGGTTCCAAGG + Intronic
1069518697 10:69100722-69100744 CTGCATTTCTCAGGCTCCCAGGG + Intronic
1070281348 10:75051097-75051119 CTGCTCTCCTAGGCCTTCCAGGG - Intronic
1070292834 10:75132051-75132073 CTCCTTTGCCTAGGCTTCCAAGG - Intronic
1070836089 10:79447665-79447687 CTGCTGTCTTTGAGCTTCCAAGG + Intergenic
1070838425 10:79466367-79466389 CTGCCTTCCTTGGCCTGCCAAGG - Intergenic
1072402819 10:95122613-95122635 CTGCTTTTCCTGGCTCTCCATGG + Intergenic
1073365821 10:102940195-102940217 CTGCCTGCCTTGGCCTTCCAAGG + Intronic
1073819161 10:107240312-107240334 CTGTTTTTCTTGCACTTCAAAGG - Intergenic
1073978057 10:109122708-109122730 ATGCTATTCTAGGGCTGCCATGG - Intergenic
1074399354 10:113129055-113129077 CTTCGTTTCTTCTGCTTCCAGGG + Intronic
1075486503 10:122826354-122826376 CTGCTTTTCCTTGGCCTCCATGG - Intergenic
1076133087 10:128027336-128027358 CTGCTTTTGTGGGGCCTGCATGG + Intronic
1076599542 10:131647953-131647975 CTGCTTTTCAGGGCCTTCCGAGG - Intergenic
1076674763 10:132142192-132142214 CTGGTTTTGATCGGCTTCCATGG - Intronic
1077021188 11:417785-417807 CAGTTTTCCATGGGCTTCCAAGG - Intergenic
1078227941 11:9409907-9409929 CTGTTTTTTTTTGGCTTCCAGGG + Exonic
1078555931 11:12326125-12326147 CTGCTGTACTTGTGATTCCAGGG + Intronic
1079390327 11:20016750-20016772 CTGCCTTCCTTGGCCTCCCAAGG - Intronic
1080255615 11:30287555-30287577 CTGCCTTTATTAGGTTTCCAGGG - Intergenic
1080783204 11:35449889-35449911 CTGCTTTTCCTTGCTTTCCATGG + Intronic
1081330644 11:41795807-41795829 ATGCTTCTCTTAGGGTTCCATGG - Intergenic
1083555760 11:63625742-63625764 CCGCCTGTCTTGGCCTTCCAGGG - Exonic
1084680121 11:70662120-70662142 CTGATTTTCCCGGGCTTCCCTGG - Intronic
1084882586 11:72182175-72182197 CTCCTGTTCTTGGTTTTCCAGGG - Intergenic
1085731382 11:79001989-79002011 CTGCTTTTCTGGTGCATCCAGGG + Intronic
1086575198 11:88331611-88331633 CTGTTCTTCTTGGGCTTTTATGG + Intronic
1086739772 11:90352660-90352682 CTGTTTTTTTTGGCCATCCAAGG + Intergenic
1089027325 11:115284939-115284961 CTGTATTTCTTTGTCTTCCATGG - Intronic
1089644968 11:119872971-119872993 CTGCTTTCCCTGGGGGTCCAAGG - Intergenic
1090040506 11:123286679-123286701 CTGCTTTAAATGGGCTACCACGG + Intergenic
1092151530 12:6252188-6252210 CTACTTTGCTTGGCCTTCTATGG + Intergenic
1092384290 12:8023890-8023912 GTTTGTTTCTTGGGCTTCCAGGG + Intergenic
1093445086 12:19247861-19247883 CTGTTATTCTAGAGCTTCCAGGG - Intronic
1096834176 12:54338056-54338078 TTGCTTTTCTTTGGGTTCTAGGG + Intronic
1097397578 12:59094476-59094498 CTGGATTCCTTGGCCTTCCATGG + Intergenic
1098503104 12:71217214-71217236 CTGCTTATCTTGTTCTTCCATGG + Intronic
1099435335 12:82635427-82635449 CAGCTTTCCTTGTGCTTCCTGGG + Intergenic
1099449221 12:82788776-82788798 CTGCTTTTCTTCTCTTTCCAGGG + Intronic
1100347592 12:93747707-93747729 CTGCCTGCCTTGGCCTTCCAAGG + Intronic
1100771400 12:97926724-97926746 CTGTATTTCTTGGGCATCCTTGG + Intergenic
1102021323 12:109685335-109685357 CTGCTTTTCATAGTCTTGCAAGG + Intergenic
1102497561 12:113330062-113330084 CTGCTTTGCTTAGGCTATCATGG - Intronic
1103548697 12:121720464-121720486 CTGCCTATCTTGGCCTCCCAAGG - Intronic
1106417331 13:29557220-29557242 CTACTCTTGATGGGCTTCCAGGG + Intronic
1107102509 13:36609464-36609486 CTGCCCTTCTTGGGATTCTAGGG - Intergenic
1107282777 13:38755669-38755691 CTGATTTTCTTGGGCTATAAAGG - Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108933564 13:55861409-55861431 CTGCTTTTCTTTGGCTTTACGGG + Intergenic
1109617098 13:64849366-64849388 ATGGTTTTCTTTGGCTTCTAAGG + Intergenic
1110467615 13:75820182-75820204 CTGCTTATCTTTGGCTTTTAGGG - Intronic
1111105026 13:83633967-83633989 ATGTTTCTCATGGGCTTCCAGGG + Intergenic
1111596543 13:90419474-90419496 CTGCTTGCCTTGGCCTCCCAAGG + Intergenic
1112588417 13:100740614-100740636 CAGCTTACCTTGGGCTCCCAAGG - Intergenic
1114303668 14:21401240-21401262 CTACTTTTCTGGGGCCTCCTAGG + Intronic
1115229389 14:31142837-31142859 CTGCCTTCCTTGGCCTCCCAAGG - Intronic
1119830407 14:77697099-77697121 CTGCTCTTCTTTGGGGTCCATGG - Intronic
1120052308 14:79881453-79881475 CTGCTTTGCATGGCCTTCCCCGG - Intergenic
1120554199 14:85908271-85908293 CTGCTTTGGTTTGCCTTCCATGG + Intergenic
1121747404 14:96308829-96308851 CTGCTTCCCTTTGGCTTTCAAGG + Intronic
1121893554 14:97622448-97622470 TTGATTTTCTTGAACTTCCATGG - Intergenic
1122077359 14:99245136-99245158 CTGCTTTTCTGGGCCTTTAAGGG + Intronic
1122545402 14:102519042-102519064 CTGCCTGTCTTGGGCTTCCAAGG - Intergenic
1123104735 14:105835583-105835605 CTTCTCTTCTTGGCCTTCCTAGG + Intergenic
1124829605 15:33135127-33135149 CCGCTTTTTTTGGTCTCCCAAGG + Intronic
1125628735 15:41130614-41130636 CTACTTTTCTCTGACTTCCATGG - Intergenic
1126170646 15:45692748-45692770 CTTCTTTTCCTGGGATGCCAAGG + Intergenic
1129771666 15:78206836-78206858 ATGCTTTTCTGGGGCTCCAAGGG + Intronic
1130918720 15:88326153-88326175 CTTCTTCTCTAGGACTTCCATGG - Intergenic
1133784080 16:8962127-8962149 CTGCTTTTCCTGAGCTCCCCTGG + Intronic
1135953620 16:26937656-26937678 ATGCTCTTCATGGTCTTCCAGGG - Intergenic
1136372054 16:29842674-29842696 CTCCTTTTCTTGGGGTTCCTAGG - Intronic
1136989329 16:35142520-35142542 TTGCTTTTCTTTGGCTTTCTTGG + Intergenic
1137695730 16:50460846-50460868 CTGCTTCTCTTGGTCTTGCTGGG + Intergenic
1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG + Intergenic
1137760351 16:50935393-50935415 CTGCCTTGCTTGTGCTTCCTGGG + Intergenic
1139121143 16:64018796-64018818 CTACTTTTGTTGGGTTTCCCAGG + Intergenic
1139195303 16:64911261-64911283 CTGCTTATCTTAGCCTCCCAAGG - Intergenic
1139356887 16:66371880-66371902 CTGCTTTTCTTGGGACTGCCTGG - Intronic
1140017944 16:71206180-71206202 CTGCTGTTCATGTGCTTCCTGGG - Intronic
1141229049 16:82147219-82147241 CTGCTTCTCTTGAGTTCCCAAGG - Intergenic
1141998504 16:87649649-87649671 CTGCTTTTATTTGGTTTCCACGG - Intronic
1142200885 16:88760661-88760683 CTGCCTGTCCTGGGCTTCCTGGG - Intronic
1143109780 17:4546500-4546522 CTGCCTTTCTTGAGTGTCCAAGG - Intronic
1144672554 17:17141160-17141182 CTGCTTTCCTGGGGCTTTCTAGG + Intronic
1145289476 17:21531871-21531893 CTGCTTTTCTATGGTTTCCATGG - Exonic
1146522795 17:33539345-33539367 CTGCTTTTCTTGCCCTACAATGG + Intronic
1146565985 17:33913132-33913154 CTTCTTTATTTGGGCTTACAAGG + Intronic
1147626984 17:41906727-41906749 CACCTTTTCATGTGCTTCCAGGG - Intronic
1149141925 17:53441581-53441603 CTGCTTTGTTTGGGTTCCCAAGG - Intergenic
1151805011 17:76399823-76399845 CTTCTTGTCTGGGTCTTCCATGG + Exonic
1152888046 17:82864203-82864225 CAGCTTCACTTGTGCTTCCAGGG + Intronic
1153433720 18:5046750-5046772 TTTCTTTTCTGGGGCTTCAATGG - Intergenic
1153526667 18:6001358-6001380 CTGCTTTCCTTGGTCGTGCATGG - Intronic
1153764558 18:8363060-8363082 CTGCTTGTCATGCGCTTTCAGGG + Intronic
1156323797 18:36054245-36054267 CTGCCTGTCTTGGCCTCCCAAGG - Intronic
1156954406 18:42944002-42944024 CTGCTTTTCCTGCCCCTCCAGGG + Intronic
1157523205 18:48359622-48359644 CAGCTTTTGATGGGCTTTCAAGG - Intronic
1157815232 18:50725257-50725279 CTGCCTTTGTTGAACTTCCAGGG + Intronic
1158273357 18:55740293-55740315 GTGATTTACTTGGGCTGCCAGGG + Intergenic
1158801109 18:60910756-60910778 CTGATTATTTTTGGCTTCCAAGG - Intergenic
1158803235 18:60938190-60938212 CTGTTTGTCTTTGGCTTTCATGG + Intergenic
1160196383 18:76758926-76758948 CTGCTTTTCTTCCTTTTCCAAGG + Intergenic
1160398249 18:78588076-78588098 CTGTCTTTCTTGTGCTTCGATGG - Intergenic
1160492670 18:79351144-79351166 ATGCTTTTCTATGACTTCCAAGG - Intronic
1163348066 19:16757292-16757314 CAGCGTTTCTTGGGCTCGCATGG - Intronic
1164014701 19:21242989-21243011 CTGCTTTTGTTGGGTCCCCAGGG - Intronic
1164406679 19:27954236-27954258 ATAATTTTCCTGGGCTTCCATGG + Intergenic
1164869492 19:31631449-31631471 CTGGTTTTCTTGGGGTTCACAGG + Intergenic
1165166330 19:33859864-33859886 CTGCCTTGCTTGGCCTCCCAAGG + Intergenic
1165776315 19:38406403-38406425 CTGCCTGCCTTGGCCTTCCAAGG + Intronic
1166617507 19:44263838-44263860 CTGCTTTTCTGCAGCTTGCAGGG + Intronic
1167693930 19:51003068-51003090 CGGCCTCTCTTGGTCTTCCAAGG + Exonic
1168465864 19:56600733-56600755 CTGCTTTTCTTTTGTTTCAAGGG + Intronic
925045380 2:769331-769353 CTGACTTTCTTGGTCTTCTAGGG + Intergenic
926306511 2:11640743-11640765 CTGCCATTCGTGTGCTTCCATGG + Exonic
928708949 2:33982712-33982734 CTACTTTTCCTTGGCTCCCAAGG - Intergenic
929037809 2:37711468-37711490 CTGCTTCTCTTTGCCTTCCTTGG - Intronic
929944850 2:46362546-46362568 CTTTTTTTCCTGGGGTTCCATGG - Intronic
929995193 2:46821620-46821642 CCACTTTTCTGGGGCCTCCAAGG + Intronic
931503149 2:62893798-62893820 CTGCCTGTCTTGGCCTTCCAAGG - Intronic
931513654 2:63027568-63027590 CTGCTTTGCTTAGGCTTCTGTGG + Intronic
931764600 2:65443733-65443755 CAGCTTTCCTTTGACTTCCATGG - Intergenic
932819667 2:74888883-74888905 CTGCTGTTCATGGGTTTGCAGGG - Intronic
934709017 2:96503232-96503254 CTGCTTCTCAAGGGCTCCCAGGG - Intronic
935210701 2:100937597-100937619 CGGCACTTCTTGGCCTTCCACGG - Intronic
936462642 2:112723940-112723962 CTCCATTTCTTGGCCTTTCAAGG + Intronic
936706375 2:115079622-115079644 CTGCTTTTCCTGTGGTCCCATGG - Intronic
937293307 2:120794890-120794912 CTGACTTTCTTGGGCTTTCTGGG + Intronic
938833854 2:135079481-135079503 CTGATATTCATAGGCTTCCATGG + Intronic
938840991 2:135163331-135163353 CTCCTTTTCTAGGGATTCCTTGG + Intronic
939556505 2:143680581-143680603 GTTCTTCTCTTGGGCCTCCATGG + Intronic
939967371 2:148623693-148623715 CTCCTTTTCTTGGGCCCCCAAGG + Intergenic
940057253 2:149525986-149526008 CTGCTTTTCTTTGTTCTCCATGG + Intergenic
940124430 2:150309017-150309039 CTGCTTTTCTTTGATCTCCATGG - Intergenic
941676667 2:168350041-168350063 ATGTTTTTCTTTGGCTTCTAGGG - Intergenic
942269015 2:174255503-174255525 CTGTCTTCCTTGGGCTTCCCTGG + Intergenic
942475189 2:176311878-176311900 CTGCTTTTCCTAGCCCTCCATGG + Intronic
947348389 2:229217787-229217809 CTGCTTCTCATGGCATTCCAAGG + Intronic
1169126149 20:3128383-3128405 CTGCTTTCCTTTGGCATCCTAGG - Intronic
1169153339 20:3307729-3307751 CCTCTTTTGTTGGACTTCCAGGG - Intronic
1169789200 20:9391844-9391866 CTGCTCTTCTCTGCCTTCCAGGG + Intronic
1170613807 20:17933781-17933803 CTCCTGTCTTTGGGCTTCCATGG - Intergenic
1172330715 20:34074496-34074518 CTGTTCTTCTTGGGCTGCCTGGG - Intronic
1173213945 20:41061885-41061907 ATTCTTAACTTGGGCTTCCATGG + Intronic
1173583763 20:44166515-44166537 CAGTTTTTCTTGGGCTTAAAGGG - Intronic
1173776574 20:45713821-45713843 CTGCTTTTCTTCGCTCTCCATGG - Intergenic
1174674381 20:52339509-52339531 CTGCTTTTCTTTGCCATGCAAGG + Intergenic
1175461562 20:59155587-59155609 CAGCTTTACCTGGACTTCCAAGG - Intergenic
1175585456 20:60135737-60135759 CTGCTTTTCCAGGGTTTCCTAGG - Intergenic
1178232836 21:30806849-30806871 CTACTTTTCTTTGAGTTCCAAGG - Intergenic
1178256989 21:31062558-31062580 CAGCTTTCCTTGGGCTGCAAGGG + Intergenic
1178810466 21:35876909-35876931 CCGTGTTTATTGGGCTTCCAGGG - Intronic
1179528449 21:42000323-42000345 CTTCCTTTCTTGTGCTTCCTGGG + Intronic
1184875688 22:47274027-47274049 TTGCTTTTCTGGAGCCTCCAGGG + Intergenic
950466871 3:13161008-13161030 CTGCCTTTCTGGAGCTTTCAGGG - Intergenic
950677174 3:14561344-14561366 CTGCTATTCTCTGGCCTCCATGG + Intergenic
950705132 3:14774782-14774804 CTGCTCTCCTGGGGTTTCCATGG - Intergenic
950816619 3:15710445-15710467 CTGGTTTTCTTGTTCTTCCAAGG - Intronic
951395640 3:22162947-22162969 CTGCTTTTCTTACGCTTCACAGG - Intronic
952268445 3:31809184-31809206 ATGATTTTCTTGGGCTTTCCAGG - Intronic
952456743 3:33479589-33479611 CTGCCTGTCTTGGTCTTCCAAGG + Intergenic
952739474 3:36721733-36721755 TTGCTTTTCTTGACCTTGCATGG - Intronic
953476055 3:43206751-43206773 CTGCTTTTCTCCAGCTTCCGTGG + Intergenic
954630154 3:52043682-52043704 CTGCTTTCCTCGGGCTGGCATGG + Intergenic
954648531 3:52145702-52145724 CTGGGTTTGTTGGGATTCCAGGG - Intronic
956941785 3:74170505-74170527 CTACATTTCTTGGTCTTCCTTGG - Intergenic
956959236 3:74378846-74378868 TTGCTTTTGTAGGGCTACCATGG + Intronic
958085181 3:88797477-88797499 CTGCTTTTGATGGCCTGCCAAGG + Intergenic
958743316 3:98101638-98101660 CTGCTTGTGTTGTGTTTCCAGGG + Intergenic
959186861 3:103056065-103056087 CCATTTTTCTTGGTCTTCCAGGG + Intergenic
959427518 3:106209934-106209956 ATGCTTTTGATGGACTTCCAAGG - Intergenic
960075565 3:113481143-113481165 CTGATTTTCTAGGGGTTCCTAGG - Intronic
960469705 3:118047514-118047536 CTGCTTGCCTTGGCCTCCCAAGG - Intergenic
960707796 3:120497120-120497142 CTGAGTATCTTGGGTTTCCAGGG - Intergenic
961044257 3:123698117-123698139 CAGCTGTTCTTGGGCTTGCATGG - Intronic
961554729 3:127690188-127690210 CTGCTTTTCCTGAGTTCCCATGG + Exonic
963755898 3:149235001-149235023 CTGCTTTTCTTCATTTTCCACGG - Intergenic
963922930 3:150923483-150923505 ATGCTTCTCTAGGGCTCCCAAGG - Intronic
964132363 3:153303593-153303615 TTTTTTTTCTTGTGCTTCCATGG - Intergenic
964336076 3:155655583-155655605 AGGCTTTATTTGGGCTTCCATGG - Intronic
964512438 3:157467589-157467611 CTGCATTTCTGGGACCTCCAGGG + Intronic
964581841 3:158247886-158247908 CTGCTTTTCTTCAGTTTTCATGG + Intronic
964744854 3:160002840-160002862 CTACTTTTCTTGGACTTTCACGG - Intergenic
965474233 3:169134413-169134435 TTGCTTTTCTTTGCCTTTCATGG - Intronic
965548400 3:169938617-169938639 CAGCCTTTCTGGGGCTTTCATGG + Exonic
966724535 3:183097839-183097861 TTTCTTTTCTTAGGCCTCCAGGG - Intronic
967092941 3:186150726-186150748 CCTCTTTTCTTGGCCTTCGAGGG + Intronic
967589467 3:191256331-191256353 ATGTTTTTCTTGGACTTCCACGG + Intronic
968859400 4:3154383-3154405 CTGCCTTTCTTGGGACTCAACGG - Exonic
969303823 4:6313604-6313626 CTGCTCATCTTGGCCTCCCAAGG - Intergenic
969392400 4:6900597-6900619 CTGCTGTTCCTGGGCCTCCAGGG + Intergenic
969587311 4:8101805-8101827 CTGGTTTACTTGGCCTTCAAAGG - Intronic
969952785 4:10854742-10854764 CTGCTTTTCTTCGTTCTCCATGG + Intergenic
970106782 4:12594845-12594867 CTGCTTTTCTTTGCTCTCCATGG - Intergenic
971362696 4:25952019-25952041 CTGTCTGTGTTGGGCTTCCAGGG - Intergenic
971407336 4:26334283-26334305 CTGCCTGCCTTGGCCTTCCAAGG + Intronic
971509358 4:27405004-27405026 CTGATTTTCTTTGGCTTAGAGGG + Intergenic
974070704 4:57121009-57121031 CTTCTTTTCATGGCCTTCCCTGG + Intergenic
974129768 4:57739455-57739477 ATGTTTTTCCTTGGCTTCCATGG - Intergenic
975714297 4:77190603-77190625 CCTCTTTTCTTGGGCTTTCCAGG + Intronic
976365333 4:84227381-84227403 GTGCTTTCCATGGGCTTCAATGG - Intergenic
977006551 4:91573675-91573697 TTGCTTTTCTTTGTTTTCCATGG + Intronic
978127043 4:105147029-105147051 CGCTTTTTCTCGGGCTTCCAGGG + Intronic
979218834 4:118197631-118197653 CTGCTCTTTTTTGGTTTCCATGG + Intronic
981225469 4:142289250-142289272 ATACTTTTCTAGGCCTTCCAGGG + Intronic
981258987 4:142696789-142696811 CTGCTTTTCTTGGACAGCCTTGG - Intronic
981833084 4:149024168-149024190 CTGTCTTTATTGGGCTACCATGG - Intergenic
982068673 4:151675975-151675997 CTGCCTGTCCTGGGTTTCCAAGG + Intronic
982443089 4:155459378-155459400 CTGGATTTCTTGGGCATCTATGG + Intergenic
984764894 4:183392727-183392749 CCGATTTTCTTGGGTTTCCCAGG - Intergenic
985171062 4:187150632-187150654 CTCCATTACTTGTGCTTCCAAGG - Intergenic
985772500 5:1821685-1821707 TTGCTTTTCTTGGTGTTCCTTGG + Intergenic
986131045 5:4930514-4930536 CTTCTTTGCTGGGGCTGCCAGGG - Intergenic
988217837 5:28299918-28299940 CTGCTTTTTTTGGTTTTACATGG - Intergenic
988703206 5:33696995-33697017 CTTTTTTTCTTGGGCTAACAAGG - Intronic
988705537 5:33722958-33722980 CTGCTTTTCTTGGGCTTCCAGGG - Intronic
989697253 5:44216673-44216695 CTGATATTCTTGGTCTTCCTAGG + Intergenic
990179073 5:53140737-53140759 CTGTTTGCCTTGGCCTTCCAAGG - Intergenic
991776102 5:70087484-70087506 CTGCCTTCATTTGGCTTCCAGGG - Intergenic
991855390 5:70962938-70962960 CTGCCTTCATTTGGCTTCCAGGG - Intergenic
991869397 5:71095716-71095738 CTGCCTTCATTTGGCTTCCAGGG - Intergenic
992118554 5:73565980-73566002 ATGCTCTTCTGGGGCTTCCCAGG + Intronic
992467752 5:77023952-77023974 ATTTTTTTCTTGGGCCTCCAGGG + Intergenic
992658400 5:78933333-78933355 CTAGTTTTCTTGGGGATCCATGG - Intronic
995372917 5:111439742-111439764 CTGCTTTTTCTGTGTTTCCAGGG - Intronic
995891862 5:116962922-116962944 CTGCCTTTCTTTGTATTCCAAGG + Intergenic
997167492 5:131676512-131676534 CTGCTCATCTTGGCCTCCCAAGG - Intronic
997832922 5:137167136-137167158 CTGCTCTTTTATGGCTTCCATGG - Intronic
997902759 5:137783149-137783171 CCTCTTTTCATGGGCTTCCCTGG - Intergenic
998321238 5:141234593-141234615 CTGCTTTTCTTTGTTTTCCTGGG + Intergenic
999666489 5:153917779-153917801 CTGCTTTTCTTTGTTCTCCATGG + Intergenic
1000275034 5:159726451-159726473 CTGCCTGTCTTGGCCTCCCAAGG - Intergenic
1001889118 5:175324418-175324440 CACCTTTACTTGGGTTTCCAGGG - Intergenic
1002166774 5:177352403-177352425 CAGCTTTCCTGGGCCTTCCATGG - Intergenic
1003105819 6:3214867-3214889 CAGCTTTTGTTGGGCTTTAAAGG - Intergenic
1004402838 6:15304789-15304811 CTGTTTTTCCTGGGAGTCCATGG + Intronic
1005636938 6:27761820-27761842 CAGCTTTCCTTGGCCTTCCCAGG + Intergenic
1006695725 6:35929045-35929067 CCTCTTTTCTTGTGCTTCCAGGG - Intergenic
1006921116 6:37627817-37627839 CTGCTTTTGGGGGGGTTCCAGGG + Intergenic
1008137628 6:47795208-47795230 ATGCTTTTCTTCCGCCTCCAGGG + Exonic
1009066051 6:58563989-58564011 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009066276 6:58567049-58567071 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009066931 6:58576225-58576247 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009071752 6:58643443-58643465 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009071969 6:58646500-58646522 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009075259 6:58692355-58692377 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009076563 6:58710697-58710719 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009078762 6:58741252-58741274 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009080706 6:58768265-58768287 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009081363 6:58777416-58777438 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009083115 6:58801879-58801901 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009084215 6:58817145-58817167 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009085097 6:58829376-58829398 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009086846 6:58853816-58853838 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009087066 6:58856873-58856895 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009092763 6:58936288-58936310 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009094950 6:58966861-58966883 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009096483 6:58988264-58988286 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009097368 6:59000491-59000513 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009098469 6:59015773-59015795 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009099127 6:59024921-59024943 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009099572 6:59031032-59031054 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009101991 6:59064664-59064686 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009106567 6:59128335-59128357 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009108331 6:59152770-59152792 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009108550 6:59155829-59155851 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009108770 6:59158887-59158909 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009109209 6:59165001-59165023 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009114459 6:59238331-59238353 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009114680 6:59241388-59241410 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009115117 6:59247501-59247523 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009116220 6:59262793-59262815 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009119071 6:59302319-59302341 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009120122 6:59317077-59317099 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009120344 6:59320132-59320154 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009120563 6:59323190-59323212 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009122535 6:59350537-59350559 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009124299 6:59374963-59374985 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009126488 6:59405520-59405542 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009135579 6:59531943-59531965 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009138655 6:59574735-59574757 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009139698 6:59589178-59589200 CTGTTTTTGTAGGGTTTCCAAGG + Intergenic
1009141016 6:59607528-59607550 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009143667 6:59644154-59644176 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009145864 6:59674702-59674724 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009146748 6:59686934-59686956 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009150911 6:59745013-59745035 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009152670 6:59769472-59769494 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1009156865 6:59827808-59827830 CTGTTTTTGTAGGACTTCCAAGG + Intergenic
1010584065 6:77636139-77636161 CTGTTTTTCTTGGCTTTCCCTGG + Intergenic
1011370881 6:86634962-86634984 TTGCTTTTCTTGGTTCTCCATGG + Intergenic
1011820721 6:91250274-91250296 CTTGTTTTCCTGGGCTTGCATGG + Intergenic
1013251541 6:108339381-108339403 CTGCTCATGTTGGCCTTCCAGGG + Intronic
1013778536 6:113705079-113705101 GTTCCTTTCTTGGGATTCCATGG - Intergenic
1014410488 6:121112517-121112539 CTGCTTTTCTTTGGTTGCCAAGG - Exonic
1014976866 6:127897719-127897741 TTGCTTTTCATTAGCTTCCAAGG + Intronic
1017899365 6:158705920-158705942 CTGTTTTTCTCTTGCTTCCATGG + Intronic
1018172435 6:161153113-161153135 CTGCTTTTCCTGGGGTGCCCAGG - Intronic
1020618960 7:10495991-10496013 CTGCTTTTCTTTGCTTTCCATGG - Intergenic
1021577266 7:22115958-22115980 CTGCTGTTCAGGGTCTTCCAGGG + Intergenic
1021739137 7:23667798-23667820 CTGCCTGCCTTGGCCTTCCAAGG + Intergenic
1025812071 7:64881849-64881871 TTGATTTTCTTGTGCTTTCACGG + Intronic
1026272512 7:68848973-68848995 TTGCTTTTCTTGAGATTCAAGGG - Intergenic
1026459778 7:70603697-70603719 CTGATTTTCTTTGGCTGGCAGGG - Intronic
1027052029 7:75026579-75026601 CTCCTTCTGGTGGGCTTCCAGGG - Intergenic
1028903566 7:96127995-96128017 CTGCCCTTCTTGGGGTTGCACGG + Intronic
1029927700 7:104335019-104335041 GTGCTCTTCTTGGACTCCCATGG + Intronic
1030487629 7:110190449-110190471 CTGCCTGTCTTGGCCTCCCAAGG - Intergenic
1032242440 7:130174467-130174489 CTGCTTTTCTAGGGTTGCTATGG - Intronic
1032324152 7:130911071-130911093 CTGCTGTTCTTAAGCTTCCCAGG - Intergenic
1032370351 7:131343764-131343786 CTGCTTTTCCGGGGCATACAGGG + Intronic
1033579109 7:142715570-142715592 CTGGGTCACTTGGGCTTCCAGGG - Intergenic
1036684422 8:10899725-10899747 CTGGTTTTCTGAGGCTTCCAAGG + Intronic
1036943864 8:13075918-13075940 GTTCTTTTCTTGGGATTCAATGG + Intergenic
1039362934 8:36899927-36899949 CTGCTTTGCTTGGGTTTCCCAGG - Intronic
1039378475 8:37061555-37061577 CTGCTTTTCTTAGCTTCCCATGG + Intergenic
1039997909 8:42550445-42550467 CTGTTTTTCTAGAGCCTCCAAGG + Intronic
1041100203 8:54389165-54389187 CTGCTTTTACAGGACTTCCAGGG - Intergenic
1041154659 8:54972983-54973005 CCGAGTTTCTTGAGCTTCCAAGG + Intergenic
1041615182 8:59898830-59898852 CTGCTTTTCTCGGTTTTCCATGG - Intergenic
1042013404 8:64277199-64277221 CTACTTTTGTGGGGCTTTCATGG + Intergenic
1042097641 8:65234971-65234993 CTGCTTTCCATGAGCATCCAGGG - Intergenic
1042320852 8:67474083-67474105 TTGCTTTTCTATGGCTTCCATGG - Intronic
1042520605 8:69707539-69707561 CTCCTTTTCATGGTCTTTCATGG - Intronic
1043074520 8:75680680-75680702 CTGCTTTTCTTGTACTTCGTTGG + Intergenic
1045676500 8:104614071-104614093 CTGCTGTCCTTGTGCTTCCTGGG + Intronic
1045801575 8:106107942-106107964 ATGATTCTCTTGGACTTCCAGGG + Intergenic
1046286023 8:112093147-112093169 CTGCTCTCCATGGGTTTCCATGG + Intergenic
1046676858 8:117119027-117119049 CTCCTTTTGTTTGGCTCCCATGG + Intronic
1047777127 8:128081665-128081687 CTGCTCTTCTATGGCTTCCATGG + Intergenic
1048274453 8:133055745-133055767 GTGCTTTACTTGGGCACCCAGGG + Intronic
1049092981 8:140530675-140530697 CTGCTATCCTTGGGCCTCCCAGG + Intergenic
1049340376 8:142109248-142109270 CTGCGGTTCTTGGACCTCCAAGG - Intergenic
1049776178 8:144406408-144406430 CTGCCTTCCCTGGGCCTCCAGGG + Intronic
1049985053 9:942514-942536 CTGCTTGCCTTGGCCTCCCAAGG + Intronic
1050548143 9:6726561-6726583 CCGCTTCTCTTTGGCTACCATGG + Intronic
1050766595 9:9142196-9142218 CTGCTCTTCTAGGGCTTCTATGG - Intronic
1052459490 9:28744362-28744384 CTGCTTTTCTTTTGCCTGCATGG + Intergenic
1052626222 9:30980691-30980713 TTGCTTTTCTTTGTTTTCCATGG - Intergenic
1052917506 9:33934878-33934900 CTGGTATTGTTGGGCTGCCAAGG - Intronic
1053051302 9:34962963-34962985 GGGCTTTTCTGGGGTTTCCAAGG - Intronic
1056706234 9:88954694-88954716 CTTCTTTTCTTGGGCTTAATTGG - Intergenic
1056823734 9:89862665-89862687 CTGTTCTTGCTGGGCTTCCAAGG - Intergenic
1056889471 9:90477601-90477623 CTGCCATTCCTGGGCTGCCAAGG + Intergenic
1057735224 9:97652243-97652265 CTGCCTGCCTTGGGCTCCCAAGG + Intronic
1059438197 9:114288893-114288915 CTGTCTCTCTTTGGCTTCCAGGG + Exonic
1061235066 9:129337339-129337361 TTTCTTTTCTTGGGCTTCCAGGG + Intergenic
1185764632 X:2715499-2715521 CTCCTTTTCTTTGTCTTACAAGG + Intronic
1186077782 X:5899046-5899068 CTTCTTTTATGGGGCTGCCATGG + Intronic
1187149168 X:16666376-16666398 ATGCTTTTATTGAGATTCCAGGG + Intronic
1187594453 X:20756071-20756093 CAGCATTTCTGGGGCTTCCCTGG - Intergenic
1188747076 X:33858668-33858690 CTGGTTTTCTTGGTCTCCCTGGG - Intergenic
1189546103 X:42044283-42044305 CTGCTTCCCTTGAGTTTCCAAGG + Intergenic
1196537894 X:116868587-116868609 CTGCTTTTCTTCATTTTCCATGG + Intergenic
1196840330 X:119853274-119853296 CCGCTTTTGTTGGGCGTTCAGGG + Intergenic
1196893121 X:120309365-120309387 CTTTCTTTCTTGGGCTCCCAGGG - Intronic
1198532284 X:137558709-137558731 GGGCTTTTCTTGGGCCTTCAGGG + Intergenic
1198692259 X:139297087-139297109 CTAATTTTCTTATGCTTCCATGG - Intergenic
1199236819 X:145502463-145502485 CTGCTTTTCTTAGACTTTCTAGG - Intergenic
1199811382 X:151353164-151353186 CTGCTTTCCCTGGGTTCCCAAGG - Intergenic
1199868459 X:151875323-151875345 CTGCTGTTCTTGGGCAAGCAAGG - Intergenic
1199882057 X:151981705-151981727 CTGCATTTCTTCAACTTCCACGG - Intergenic
1200827786 Y:7661107-7661129 CGGCTTGTGCTGGGCTTCCAGGG - Intergenic
1201960830 Y:19679340-19679362 CTGCTGTTCTTTGGTTTCGAGGG - Intergenic