ID: 988707582

View in Genome Browser
Species Human (GRCh38)
Location 5:33740896-33740918
Sequence GGAGACAGTGGAGCACGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988707582_988707585 -1 Left 988707582 5:33740896-33740918 CCAGCTCGTGCTCCACTGTCTCC 0: 1
1: 0
2: 3
3: 18
4: 284
Right 988707585 5:33740918-33740940 CTCAGACTTCACTTATAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988707582 Original CRISPR GGAGACAGTGGAGCACGAGC TGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900661137 1:3784357-3784379 GGAAACAGTTGTGCATGAGCTGG - Intronic
901758026 1:11453256-11453278 GGCGACGGTGGAGCAGGGGCAGG - Intergenic
901842632 1:11963752-11963774 GGAGAAAGAGGAGCAGGAGAAGG - Intronic
902614911 1:17618493-17618515 GGAGACAGAGGAGGAGGAGGAGG - Intronic
904117625 1:28174249-28174271 GGCAACAGTGGAGCAGGAGCCGG - Intronic
904282492 1:29430692-29430714 GGAGACAGAGCAGCAGGAGCAGG - Intergenic
905365604 1:37449649-37449671 GGAGACAGTGGAGCAGAAGTGGG + Intergenic
905519425 1:38586754-38586776 GGGCACAGTGGAGCACGGGGTGG + Intergenic
905688570 1:39926419-39926441 GGAGACCATGAAGCACAAGCTGG - Intergenic
906706269 1:47897111-47897133 GGAGAAAGTGGAGCAGGAACAGG + Intronic
906759354 1:48360577-48360599 GGAGCCAGTGGAGCTCGACTGGG + Intronic
906945482 1:50290856-50290878 GGAGACAATGGAGGAGGAGCAGG + Intergenic
907297598 1:53465257-53465279 GGAGAGACTGGAGCAGCAGCAGG + Intronic
911709832 1:101057784-101057806 GGAGACAGAAGAGCATGAGCAGG - Intergenic
912683865 1:111746793-111746815 GGAGACAGTAGATCACCAGAGGG + Intronic
913541919 1:119829531-119829553 GGAGATAGTGGAACAGAAGCAGG + Intergenic
913545256 1:119861407-119861429 GGAGATAGTGGAACAGAAGCAGG - Intergenic
914452486 1:147805080-147805102 GGAGACATTGGAGCAAAAACTGG + Intergenic
914950810 1:152111809-152111831 GGAGACGGAGAGGCACGAGCAGG - Exonic
917174469 1:172217670-172217692 GGAGAGAGTGGAGCACTGCCTGG - Intronic
917211412 1:172635521-172635543 GTAGACAGTGGAGCTTCAGCTGG + Intergenic
917678495 1:177342218-177342240 AAAGACAGAGGAGCATGAGCAGG - Intergenic
918314414 1:183311090-183311112 GAAGACAGTTGGGCAGGAGCTGG - Intronic
919746437 1:201011898-201011920 GGAGACAGTGGAGCAGGGGAGGG + Intronic
920314891 1:205070209-205070231 GGAGACAAGGTAGCAAGAGCTGG - Intronic
921790460 1:219284099-219284121 GGAGAGAGAGGAGAAAGAGCAGG - Intergenic
922286537 1:224175734-224175756 AGAGACAGTGCAGCGCGAGAGGG + Intronic
922998073 1:229982691-229982713 AGAGACAGTGGAGGAGGTGCCGG + Intergenic
924788240 1:247219979-247220001 GGAGACCGTGGAGAAGGAGAGGG - Intergenic
1063507529 10:6614312-6614334 TGAGAGAGTGGAGCATCAGCAGG + Intergenic
1064599404 10:16977794-16977816 GCAGACAGGGGTGCAGGAGCCGG - Intronic
1066520511 10:36213093-36213115 GGAGATGGTGGAGCAGGACCAGG - Intergenic
1067239109 10:44475285-44475307 GGAGACAGTGGTGCTCCACCTGG + Intergenic
1067723598 10:48749619-48749641 GGTGAAAGTGGAGCAGAAGCAGG + Intronic
1068155197 10:53188554-53188576 GGTGACAGTGGTGCAAGAGGTGG - Intergenic
1068203895 10:53822426-53822448 GGAGCAAGAGGAGCAGGAGCAGG + Exonic
1068829960 10:61482750-61482772 GGAGACAGGAGAGCAAGAGAAGG - Intergenic
1070290823 10:75112098-75112120 GGAGTCAGAGGAGCAAGACCTGG + Intronic
1070692069 10:78534243-78534265 GGAGACAGAGGAGGAGGAGGGGG - Intergenic
1073529435 10:104217732-104217754 TGATACAGTGGAGCAGGTGCTGG - Intronic
1076514200 10:131033931-131033953 GGGGAATGTGGAGCAGGAGCAGG + Intergenic
1076688302 10:132208066-132208088 GGAGCCTGTGGAGGACGAGGCGG - Exonic
1076737604 10:132465765-132465787 GGAGGCCGTGGAGAACCAGCTGG + Intergenic
1077531947 11:3101516-3101538 GGAGCCAGTGGACCAAGATCTGG - Intronic
1078876844 11:15407866-15407888 GGGGACAGTGGAGCAATGGCAGG - Intergenic
1080401988 11:31944880-31944902 GGAGAAAGTGGAGGAAGAACAGG - Intronic
1081799882 11:45850820-45850842 GGAGTCAGTGTAGAAGGAGCAGG - Intronic
1081808081 11:45900815-45900837 GGTGAAAGTGGAGCAGGAGCAGG + Intronic
1082010814 11:47448672-47448694 GGACACAGGGGAGCCCGAGGAGG + Intronic
1083679206 11:64343548-64343570 GGAGAATGTGGAGCTGGAGCTGG + Exonic
1086464864 11:87042537-87042559 GGAGACAGGAGAGCAGGAGAAGG + Intronic
1087575588 11:99985305-99985327 GCAGACAGGGGAGCAGGAGAGGG + Intronic
1088397057 11:109380484-109380506 GCAGACACTGGAGCACCAGTTGG - Intergenic
1089013251 11:115147340-115147362 TGAGACAGTGGAGCATGTGTGGG + Intergenic
1089819718 11:121213466-121213488 GAGGTCAGAGGAGCACGAGCTGG + Intergenic
1090238415 11:125165589-125165611 GGAGACAGGGGAACACCGGCGGG + Intronic
1090334673 11:125954509-125954531 GGAGAGAGAGGAGGACGGGCTGG - Intergenic
1090936088 11:131343891-131343913 GGAGAGTGTGGAGGACAAGCTGG + Intergenic
1091048588 11:132347920-132347942 GAGGACAGTGGAGGACGTGCAGG - Intergenic
1091091766 11:132777706-132777728 GGAAAGAGTGGAGCAGGAGGTGG + Intronic
1091652385 12:2319768-2319790 GGAGACAGCAGAGCACTAGATGG + Intronic
1093655286 12:21687639-21687661 AGAGGCAGTGGAGCACGGCCAGG + Intronic
1095990722 12:48032739-48032761 GGTGACTGTTGAGCAGGAGCAGG + Intergenic
1096505324 12:52088879-52088901 GGAGATGGTGGAGCACGTGAGGG - Intergenic
1097008345 12:55934986-55935008 GGAGAGAGTGGAACAAGAGGAGG + Intronic
1097170577 12:57110568-57110590 GGAGCCAGTTCAGCACGAGGAGG + Intronic
1103363680 12:120368385-120368407 GGCGGCAGTGGAGAACGCGCGGG - Intronic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG + Exonic
1104179865 12:126368815-126368837 GGAGAAAGAGGAGCAGGAGGAGG + Intergenic
1104546218 12:129715232-129715254 GGAGGAAGAGGAGCATGAGCAGG + Intronic
1104572329 12:129935913-129935935 GTAGGGAGTGGAGCAGGAGCGGG - Intergenic
1104900840 12:132188850-132188872 GGAGGGAGAGGAGCAGGAGCAGG + Intergenic
1105596889 13:21847262-21847284 GGAGACAGTGCAGCACCCACAGG - Intergenic
1106218823 13:27727571-27727593 GGAGAGGGAGGAGCAGGAGCAGG + Intergenic
1106226012 13:27787935-27787957 GGACACAGTGAAGCCAGAGCAGG - Intergenic
1107985893 13:45775886-45775908 GGGGACAGAGGAGCAAGAGGAGG - Intergenic
1113117121 13:106885405-106885427 GGGGACAGTGGAGCACGCACTGG - Intergenic
1113862346 13:113495641-113495663 GCAGGCTGTGGAGCACGAGGAGG + Exonic
1117504160 14:56385032-56385054 GGAGACAGAGGGGTACCAGCAGG - Intergenic
1117780084 14:59223134-59223156 GAAGACAGTGTAGCAGGAGTGGG + Intronic
1119564868 14:75619889-75619911 GCATACAGTGTAGCACCAGCTGG + Intronic
1120931619 14:89854706-89854728 GGGGACAGGGGAGGAGGAGCAGG - Intronic
1122093899 14:99357424-99357446 GGAGACAGTGGAGGCACAGCTGG + Intergenic
1123105013 14:105837220-105837242 GGAGACAGAGGAGCAGGGGAGGG + Intergenic
1124448701 15:29764567-29764589 GGAGGCAGTGGAGAAAGAGTGGG + Intronic
1124500483 15:30223464-30223486 GAAGGCCGTGGAGCGCGAGCAGG + Intergenic
1124723338 15:32132680-32132702 GGAGAGAGAGGGGCACGTGCTGG + Intronic
1124743091 15:32315203-32315225 GAAGGCCGTGGAGCGCGAGCAGG - Intergenic
1126798652 15:52280975-52280997 GGTAACAGGGGAGCAGGAGCTGG - Intronic
1128662030 15:69508527-69508549 GGAGGCAGTAGAACACGAACTGG + Intergenic
1129235455 15:74221267-74221289 GGGGGCAGTGGAGCAGGGGCAGG + Intergenic
1130367267 15:83251894-83251916 GGAGACTGTGGAGCAAGGGCTGG + Intergenic
1133776708 16:8902121-8902143 GGAAACAGTTGATCCCGAGCTGG - Exonic
1134055344 16:11166511-11166533 GGAGGGGGTGGAGGACGAGCTGG - Exonic
1138230542 16:55332623-55332645 GGAGACAGTGGGGCGTGAGAGGG + Intergenic
1139434405 16:66927752-66927774 GGAGAGAGTGGAGCAGAAACAGG - Intergenic
1141172514 16:81700343-81700365 GGAGAGAGAGGAGCAGCAGCAGG - Intronic
1142253215 16:89002258-89002280 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253275 16:89002434-89002456 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253383 16:89002735-89002757 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253445 16:89002911-89002933 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253466 16:89002968-89002990 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253494 16:89003042-89003064 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253527 16:89003133-89003155 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142396759 16:89836409-89836431 GGAGACAGTGGAGGAGGATCTGG - Intronic
1143015796 17:3890547-3890569 GGAGACAGAGGAGGACGAGCAGG - Intronic
1143276124 17:5712225-5712247 GGAGACAGATGAGCAGGAGGAGG + Intergenic
1143584028 17:7842577-7842599 GGTGAGAGTGGAGCGCGAGCTGG + Intronic
1143771323 17:9170808-9170830 CGACACAGTGGGGCAGGAGCAGG - Intronic
1143921083 17:10331502-10331524 GGAGTCAGTGAAGTACGTGCAGG + Intronic
1145067389 17:19771018-19771040 GGAGACATTGGAGCACCAAATGG + Intronic
1146592163 17:34136870-34136892 GGAGACAATGCTGCATGAGCAGG - Intronic
1148683990 17:49490546-49490568 GGAGAGAGCGGAGGACGAGGTGG - Intergenic
1148967180 17:51446072-51446094 GGAGACAGTGCAGCGACAGCGGG + Intergenic
1150267779 17:63842325-63842347 GGAGACGGTGGAGGGCGGGCCGG - Intronic
1150717854 17:67587086-67587108 GGAAACAGTGGAGGAGAAGCAGG + Intronic
1152132452 17:78485373-78485395 GGAGACAGAGGAGGAGCAGCCGG - Intronic
1152205217 17:78971070-78971092 TGACACAGTGGGACACGAGCAGG - Intergenic
1152507756 17:80762393-80762415 GGAGACAGTGGAGCTGGCGAGGG + Intronic
1152545216 17:80997051-80997073 GGAGGCCGTGGAGTACCAGCGGG + Exonic
1152599238 17:81253160-81253182 GGAGAGAGAGGAGCTGGAGCAGG - Exonic
1152643964 17:81460426-81460448 GGACACAGTGGAGCCCAGGCAGG - Intronic
1153747835 18:8198584-8198606 GCAGACAGTGGAGCACAAGCAGG - Intronic
1154313679 18:13286726-13286748 GGAGTCAGTGGAGAAGGAGACGG + Intronic
1155585269 18:27357004-27357026 GAAGTCAGTGGAGCTGGAGCTGG + Intergenic
1158669739 18:59464082-59464104 GGAGACAGTGGGGGAGGGGCAGG - Intronic
1158732857 18:60044916-60044938 GGACACAGGGGAGCAGCAGCAGG + Intergenic
1158884689 18:61815998-61816020 GGAGGCGGTGGAGGAGGAGCAGG - Exonic
1159637580 18:70824276-70824298 GGAGAAATTGGAGCAGGAGTAGG + Intergenic
1160229569 18:77036646-77036668 GGAGACAGCTGAGCAAGTGCTGG + Intronic
1160719335 19:590503-590525 GAAGGCCGTGGAGCGCGAGCAGG + Exonic
1161375679 19:3937990-3938012 GGGGACAGTGGAGGGGGAGCGGG - Intronic
1161767542 19:6215805-6215827 AGCGACAGTGGAGAACGTGCTGG - Intronic
1161776057 19:6262775-6262797 GGAGACAGGGGAGCCCCAGGTGG + Intronic
1162063039 19:8108291-8108313 GGAAACAGGGGAGCAACAGCAGG + Intronic
1162573914 19:11487622-11487644 GGAGACAGTGGTGTGCGTGCCGG - Exonic
1163696978 19:18768983-18769005 GGAGAAACTGAGGCACGAGCAGG + Intronic
1164897647 19:31891139-31891161 GAAGCCAGTGGAGCAGGAGGAGG - Intergenic
1166100394 19:40568136-40568158 GGAGTCAGCGGAGCACGAGGCGG + Exonic
1167747226 19:51359022-51359044 GGAGAAAGAGGAGAAGGAGCTGG + Intronic
1168293447 19:55368260-55368282 GAAGACCCTGGAGCCCGAGCTGG - Exonic
1168335965 19:55597914-55597936 GGAGACAGAGGAGCAGGTGAGGG + Intronic
1168349868 19:55669587-55669609 GGAGATCGTGGAGGACGTGCGGG + Exonic
925498432 2:4478672-4478694 GCAGAAAGTGAAGCAGGAGCAGG + Intergenic
927773502 2:25884094-25884116 GGTGACAGTGGAGCATGAAATGG - Intergenic
927853672 2:26514902-26514924 GGAGACAGTCGAGGAGGACCAGG + Intronic
928097174 2:28411929-28411951 GGAGACAGAGGAGCTGGAGGAGG + Exonic
928407264 2:31024185-31024207 GGTGACAGTGGTGCAGGTGCTGG - Intronic
928501448 2:31900639-31900661 GGATACAGTGCAGAACGTGCAGG - Intronic
930696413 2:54416284-54416306 GGAGAGAGTGGGGCAGGACCAGG + Intergenic
930975183 2:57450010-57450032 GGAGAAAGTGGAACATAAGCTGG - Intergenic
931089199 2:58867496-58867518 GGAGACAGAAGAGCAGGAGAAGG - Intergenic
931684966 2:64785001-64785023 GGAGGGCGTGGCGCACGAGCAGG + Intergenic
932807708 2:74797036-74797058 GGAGACAGTGGAGAGGGAGAGGG + Intergenic
933266460 2:80186020-80186042 GGAGAAAGGAGAGCACCAGCTGG - Intronic
933886190 2:86720679-86720701 CGTGACGGTGGAGCGCGAGCTGG + Exonic
933923991 2:87076027-87076049 CGTGACGGTGGAGCGCGAGCTGG - Intergenic
934488414 2:94738697-94738719 GGAGACAGTGGAGAGGGTGCTGG + Intergenic
934940769 2:98500400-98500422 GGAGACAATGGACCTGGAGCAGG - Intronic
935681914 2:105645467-105645489 GGAGACACTGGCGGACGTGCTGG - Intergenic
936818772 2:116492724-116492746 GGAGACAGTGAGGCAGGAGTAGG - Intergenic
937514556 2:122638515-122638537 GGAGAAAGTGGAGCGGGAGCAGG - Intergenic
940152932 2:150622743-150622765 GCAGAAAGTGAAGCAGGAGCAGG - Intergenic
941108373 2:161389299-161389321 GTAGAGAGTGGAGCTTGAGCTGG - Intronic
941580716 2:167293175-167293197 CGAGAGAGCGGAGCACGAGGAGG + Intergenic
942004221 2:171681382-171681404 GGAAACAGGGGAGGAGGAGCAGG + Intergenic
943051267 2:182916075-182916097 GGAGAGGGAGGAGCAGGAGCAGG - Intronic
943806219 2:192130285-192130307 GGAGACAGAGGAGAAGGAGGAGG - Intronic
945009617 2:205447289-205447311 GGAGACAGGTGAGCAAAAGCAGG - Intronic
948048070 2:234958616-234958638 GGAGCCAGTGGAGGAGCAGCTGG + Intronic
948072681 2:235140452-235140474 AGAGAGAGTGGAGCAGGTGCTGG - Intergenic
948233009 2:236365618-236365640 GGAGGCAGAGGAGCAAGGGCAGG + Intronic
1171485629 20:25483594-25483616 GGAGACACTGGAGCAGGTGGAGG + Intronic
1172935230 20:38615491-38615513 GGAGACTGTGAGGCCCGAGCTGG - Intronic
1173600228 20:44289696-44289718 GGATACAGAGGAGCACGTGGAGG + Intergenic
1173880281 20:46406566-46406588 GGAGACCCGGGAGCAGGAGCTGG - Exonic
1173982940 20:47239005-47239027 GGTGACCGTGGAGGACGTGCTGG + Exonic
1174182494 20:48683597-48683619 GGAGACTGTGCAGAACCAGCCGG + Intronic
1174197835 20:48786013-48786035 GAAGACAGTGGGGCCTGAGCGGG + Intronic
1174890081 20:54382592-54382614 GGAAGCAGTTGAGTACGAGCAGG + Intergenic
1175866880 20:62183289-62183311 GGAGAGAGTGGGGCAGGACCGGG - Intronic
1176219333 20:63962643-63962665 GGAGATAGCGGAGGACGAGCTGG - Exonic
1176305026 21:5118774-5118796 GGTGACTGTGGGCCACGAGCAGG - Exonic
1179828557 21:43981945-43981967 GGTGACAGAGGTGGACGAGCAGG - Intronic
1179852029 21:44143256-44143278 GGTGACTGTGGGCCACGAGCAGG + Exonic
1182246422 22:28961480-28961502 GGAGGCAATGGGGCAAGAGCTGG + Intronic
1182347188 22:29674542-29674564 GGAGACAGAGGAGCTGGAGAGGG - Intronic
1183186465 22:36294250-36294272 GCAGACTCTGGAGAACGAGCGGG - Exonic
1184035811 22:41917568-41917590 GGAGTGAGTGGAGCAGGAGAGGG + Intergenic
1185108329 22:48886688-48886710 GGAGCTAGTGCAGCAGGAGCCGG + Intergenic
1185156330 22:49195547-49195569 GGGGACAGAGGATCAAGAGCCGG + Intergenic
951455802 3:22890896-22890918 GGAGAAAGTGGAGGAGGAGGAGG - Intergenic
952712200 3:36443099-36443121 GGAGGCAGGGGAGGAGGAGCAGG + Intronic
952835416 3:37597940-37597962 GGAGACTGAGAAGCACGAGAAGG + Intronic
953669674 3:44951968-44951990 GGAGAGAGTGCAGAATGAGCAGG - Intronic
954106960 3:48414696-48414718 CGAGACAGTAGAGCAAGGGCCGG - Intronic
955146627 3:56326352-56326374 GCAGAAAGTGGAGCACTATCAGG - Intronic
955347660 3:58173109-58173131 GGAGACAGAGGAGGAGGAGGTGG - Intergenic
955528320 3:59844054-59844076 GCAGACAGTGAAGCATGAGCAGG - Intronic
956437042 3:69244270-69244292 GGAGACAATGGAAGAGGAGCTGG + Intronic
956786753 3:72649154-72649176 GAAGACTGGGGAGCAGGAGCGGG + Intergenic
959690906 3:109197173-109197195 GGATACAGTGCAGAACGTGCAGG + Intergenic
963146555 3:142000883-142000905 GGACACACTGGAGCAGGAGTTGG + Intronic
963905610 3:150771305-150771327 GGAGACAGTGAAACAGGGGCTGG - Intergenic
966817880 3:183904361-183904383 GGAGACGGTGCAGCTGGAGCTGG - Intergenic
967089651 3:186124803-186124825 CGAGGCAGTGGAGCAGGACCAGG + Intronic
967101304 3:186218091-186218113 GGAGACTGTGCTGCACCAGCGGG + Intronic
968646740 4:1744814-1744836 GAAGACAGTGGAGCAGAAGGTGG + Exonic
969125969 4:4948366-4948388 AGAGACAGAGGAGCAGGACCAGG - Intergenic
969225835 4:5797729-5797751 GGAGACAGTGGAGCCCCCGTAGG + Intronic
969486776 4:7476754-7476776 GGAGAGCGTGGAGCAGGTGCTGG - Intronic
969647634 4:8441656-8441678 AGAGACAGTGAAGGACTAGCTGG + Intronic
970531348 4:16988639-16988661 GGAGACAGTGGAGGAAGAGCAGG + Intergenic
971603273 4:28623619-28623641 GGAGATGGAGGACCACGAGCTGG - Intergenic
972196041 4:36655218-36655240 GTGGACAGTGAAGCAGGAGCAGG + Intergenic
981043820 4:140247859-140247881 GGAGAGACTTGAGCACAAGCTGG + Intergenic
981271415 4:142850560-142850582 GGACTCATTGGAGCAGGAGCTGG - Intergenic
984207130 4:176798806-176798828 AGAGAAAGTGAAGCAAGAGCTGG - Intergenic
985636490 5:1038226-1038248 TGCCACAGTGGAGCACGAGGTGG + Exonic
985969548 5:3364234-3364256 GGAAGCTGTGGAGCAGGAGCAGG + Intergenic
988087990 5:26496593-26496615 GGAGAAGGTGGAGGAGGAGCAGG + Intergenic
988707582 5:33740896-33740918 GGAGACAGTGGAGCACGAGCTGG - Intronic
990373523 5:55145736-55145758 GGAGACAGAGGAGGAGGAGGAGG - Intronic
990501255 5:56398633-56398655 GGAGACAGTGGAGAGGGAGAGGG + Intergenic
991398082 5:66225369-66225391 TGAGGCAGTGGAGCACGGGAAGG + Intergenic
992143859 5:73825454-73825476 GGAGAGAGTGGAGGAGGGGCAGG + Intronic
995052925 5:107726775-107726797 GGAAACAGTCGATCTCGAGCTGG + Intergenic
995749724 5:115441386-115441408 GAAGACAGTGTAGCAGGGGCAGG + Intergenic
996397943 5:123032120-123032142 GCAGACACTGGAGGAGGAGCAGG + Intronic
1001634722 5:173201688-173201710 GGAGGCAGTGGAGCCCAACCAGG + Intergenic
1002654392 5:180732540-180732562 GGAGACACTGGAGAACTAGACGG - Intergenic
1002913665 6:1510893-1510915 GGAGCCAGAGGAGAACGAGGAGG + Intergenic
1003178975 6:3775884-3775906 GGAGACATTGAAGCAGGGGCAGG - Intergenic
1003441637 6:6148250-6148272 GGAGGCAGTGGGGGAAGAGCAGG + Intronic
1005971228 6:30763474-30763496 GGAGAGAGGGGAGCAGGAGAAGG + Intergenic
1006389543 6:33750433-33750455 GGTGACACTGGAGCTGGAGCTGG - Intergenic
1006397449 6:33796582-33796604 GGAGGCAGGGGAGCAGGTGCTGG - Intronic
1007831065 6:44638788-44638810 GGAGGAAGGGGAGCATGAGCTGG + Intergenic
1007851167 6:44804019-44804041 GAAGAAAGTGGAGCACCAGTGGG + Intergenic
1008032586 6:46713786-46713808 GGATACAGAGGGGCAGGAGCTGG - Intronic
1009700596 6:67173301-67173323 GGAGGAAGAGGAGCAGGAGCAGG + Intergenic
1012847882 6:104412922-104412944 GGAGACAGGAGAGCAGGAGAAGG - Intergenic
1015379553 6:132551227-132551249 AGAGACAATGGAGCATGTGCTGG + Intergenic
1018243366 6:161799957-161799979 GGAGGCAGTGGAGCAAGATGAGG + Intronic
1018937699 6:168284359-168284381 GGAGAAGGAGGAGCATGAGCCGG - Intergenic
1019453169 7:1110110-1110132 GGAGACAGAGGACCTCGCGCCGG + Intronic
1021107229 7:16652018-16652040 GGAGACAGTGGATCAGGTTCTGG + Intronic
1021553706 7:21898855-21898877 GGAGGCAGTGGAGCACGTGACGG - Intronic
1022776444 7:33532284-33532306 GAATACAGTGGAGCAAGAGCTGG + Intronic
1022793683 7:33714728-33714750 GGAGAAAGAGGAGGAGGAGCAGG - Intergenic
1022793722 7:33714932-33714954 GGAGAAAGAGGAGGAGGAGCAGG - Intergenic
1023035666 7:36129365-36129387 GCAGTCAGTGGAGCATGTGCAGG + Intergenic
1023054200 7:36278596-36278618 GAAAACAGTGAAGCACCAGCTGG + Intronic
1023527105 7:41116329-41116351 GGAGACTGTAGAGCTGGAGCAGG + Intergenic
1027855212 7:83502408-83502430 GGAGAAAGTGGAGCAACACCAGG - Intronic
1027893543 7:84009825-84009847 GGAGCCCGTGGAGAAAGAGCAGG + Intronic
1028474602 7:91239498-91239520 GGAGACAGTGAAGCCAGAGAGGG - Intergenic
1029441547 7:100589684-100589706 GGAGACAGGAGGGCAGGAGCAGG + Exonic
1029977775 7:104850381-104850403 GGAGACAGGAGAGCAAGAGAAGG + Intronic
1031332405 7:120482086-120482108 GGATACAGTGGAGCTGGAGATGG - Intronic
1031670022 7:124530620-124530642 GCAGAAAGTAAAGCACGAGCAGG + Intergenic
1035049754 7:155991965-155991987 GGACACAGTGGAGCCAGGGCAGG - Intergenic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1037673356 8:21034321-21034343 GGAGACAGTAGGGCAGGAGGAGG + Intergenic
1037821001 8:22134483-22134505 CCAGACAGTGGGCCACGAGCAGG - Intergenic
1038408628 8:27341281-27341303 GGAGACAAAGGGGCACGAGACGG - Intronic
1040016769 8:42706509-42706531 GGAGACAGTGGGGAACAATCAGG + Intronic
1040280259 8:46037407-46037429 GGAAATAGCGGAGCACGAGAAGG + Intergenic
1040699601 8:50045327-50045349 GCAGAAAGTAGAGCATGAGCAGG + Intronic
1041636619 8:60152999-60153021 GGACACCGTGGAGCAGGAGGCGG + Intergenic
1045336077 8:101205460-101205482 AGAGACAGTGCAGCGCGAGAGGG + Intronic
1049176200 8:141194104-141194126 GAAGACCGTGGAGAAGGAGCTGG + Exonic
1049709640 8:144057748-144057770 GGAGGCAGGGGAGCAGGAGTAGG + Intronic
1051302708 9:15670116-15670138 GGAGTAAGTGGAGCAAGAGTAGG - Intronic
1053669374 9:40345668-40345690 GGAGACAGTGGAGAGGGTGCTGG - Intergenic
1053919174 9:42971909-42971931 GGAGACAGTGGAGAGGGTGCTGG - Intergenic
1054380504 9:64485689-64485711 GGAGACAGTGGAGAGGGTGCTGG - Intergenic
1054515242 9:66030623-66030645 GGAGACAGTGGAGAGGGTGCTGG + Intergenic
1054790054 9:69248203-69248225 GGAGCCGGTGCAGCACGAGGAGG + Exonic
1055519370 9:77064984-77065006 AGAGACAGGGGAGCAGGAGATGG - Intergenic
1056751919 9:89358061-89358083 GGAGAATGTGCAGCAGGAGCTGG + Exonic
1057294770 9:93828489-93828511 GGAGGCAGGGGAGGAGGAGCTGG + Intergenic
1057529933 9:95835778-95835800 GGACACAGTGGTGCAGGAGAAGG + Intergenic
1057790087 9:98118981-98119003 GGAGGCAGCGGTGCACGTGCAGG - Exonic
1057806121 9:98221057-98221079 GGAGGCCCTGGAGCAGGAGCGGG - Exonic
1062547625 9:137070742-137070764 GGCCAGAGTGGAGCAGGAGCTGG - Intergenic
1185661996 X:1735453-1735475 GGAGAAAGAGGAGAACGAGGAGG - Intergenic
1186101622 X:6163539-6163561 GGAGGCAGTGGACCACAGGCTGG - Intronic
1186435830 X:9542589-9542611 GAAGAGACTGGAGCAGGAGCGGG + Intronic
1187428761 X:19203071-19203093 TGGGACAATGGAGCAAGAGCTGG + Intergenic
1187826236 X:23335022-23335044 GGAGAGCGTGGAGCACCTGCTGG + Exonic
1187867860 X:23740459-23740481 GGAAACTGTGGACCTCGAGCGGG + Intronic
1190053386 X:47168652-47168674 GGTGACAGTGAAGCAGGGGCAGG + Intronic
1190274114 X:48889457-48889479 GGATACAGAGGAGCAAGAGATGG - Intergenic
1191800908 X:65078137-65078159 GGAGACAATGGAGGAAGACCAGG + Intergenic
1192291938 X:69806874-69806896 GGAGACAGTAGAGCAAGAAGAGG + Intronic
1192522573 X:71815140-71815162 GGAGACAGAGGAGAAAGAGTAGG - Intergenic
1193626875 X:83833210-83833232 GCAGAAGGTGAAGCACGAGCAGG - Intergenic
1194511486 X:94801291-94801313 GGAGACAGGGCAGCAGAAGCAGG + Intergenic
1195701350 X:107708016-107708038 GGCTACAGAGGAGGACGAGCAGG - Intergenic
1198576929 X:138020764-138020786 GGAGAAAGAGGAGGAGGAGCAGG + Intergenic
1198660742 X:138965345-138965367 GGATACAGTGGTGCACAAGATGG - Intronic
1200135137 X:153871138-153871160 GGAGACAGTGAAGCCCGTGGAGG - Exonic
1201504973 Y:14688104-14688126 GGTGACATTGGAGGATGAGCTGG + Intronic