ID: 988708880

View in Genome Browser
Species Human (GRCh38)
Location 5:33753926-33753948
Sequence GCAAGTAGGCTGCTGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988708876_988708880 10 Left 988708876 5:33753893-33753915 CCACTAGAGGAGAAGCCAGAGAT 0: 1
1: 0
2: 2
3: 19
4: 200
Right 988708880 5:33753926-33753948 GCAAGTAGGCTGCTGGTCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 138
988708877_988708880 -5 Left 988708877 5:33753908-33753930 CCAGAGATCTGCTGACATGCAAG 0: 1
1: 0
2: 0
3: 12
4: 138
Right 988708880 5:33753926-33753948 GCAAGTAGGCTGCTGGTCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988708880 Original CRISPR GCAAGTAGGCTGCTGGTCCC AGG Intronic
900180873 1:1310409-1310431 GCAAGGAGGCAGCAGGACCCTGG - Intronic
900241543 1:1619747-1619769 GCAAGTGGGGGGCTGGTTCCAGG + Intronic
900571757 1:3362052-3362074 GCTGGTAGCCAGCTGGTCCCGGG + Intronic
902214247 1:14924466-14924488 GCTCGCAGGCTGCGGGTCCCGGG - Intronic
902315593 1:15616445-15616467 GTAAGTAGGCTGTTGGTGGCAGG - Intergenic
904461786 1:30685079-30685101 GCCAAGAGGCTGCTGGGCCCGGG - Intergenic
905365637 1:37449790-37449812 GGAAGGATGCTTCTGGTCCCAGG - Intergenic
906532690 1:46532671-46532693 GAAAGTAGGCCCCTGGACCCTGG - Intergenic
906684846 1:47756640-47756662 GCAGGAAGACTGCTGGACCCAGG + Intergenic
908037643 1:60073556-60073578 GCAAAGAGGCTGCAGGTCCCCGG - Intronic
908164843 1:61447862-61447884 GCAGGTACGCTGGTGGTGCCCGG + Intronic
911561983 1:99417769-99417791 GCAGGGAGGCTGGTGGTCCAGGG + Intergenic
912476586 1:109941228-109941250 GAAATTAGTCTGCTGGTCACGGG + Intergenic
912520084 1:110239237-110239259 GAAAGTGAGCTGCTGGTCTCAGG - Intronic
912631478 1:111250028-111250050 GCCAGTGGGCTGATGGACCCTGG - Intergenic
923292002 1:232554744-232554766 GCAAGTTGGGTGTTGTTCCCAGG + Intronic
924281348 1:242440306-242440328 GAAAGTTGGTTGCTGGTCACAGG + Intronic
1062768196 10:81011-81033 GAAAGGAGGCAGCTGCTCCCAGG - Intergenic
1065750737 10:28884808-28884830 TCAAGTAGGCCCTTGGTCCCTGG + Intergenic
1068500701 10:57837816-57837838 GCTAACAGGGTGCTGGTCCCTGG - Intergenic
1069785453 10:70985042-70985064 TCTAGAAGGCTGTTGGTCCCAGG + Intergenic
1069903704 10:71720158-71720180 GCAGGGAGAGTGCTGGTCCCTGG + Intronic
1071714284 10:88079522-88079544 CCAAGTAGCCCACTGGTCCCAGG - Intergenic
1073480771 10:103784890-103784912 CCTAGTAGGCTGCCGCTCCCAGG - Intronic
1074422410 10:113320833-113320855 GCAGGCAGGCATCTGGTCCCTGG - Intergenic
1074823875 10:117201052-117201074 GCAAAGGGGCTGCTGGTCCTTGG + Intronic
1076496899 10:130903530-130903552 GCCAGGAAGCTGCTGGTCCCAGG - Intergenic
1082785002 11:57311786-57311808 GCAAGTTGGTGGCTGGGCCCGGG - Intronic
1083716689 11:64581502-64581524 GCCTGAAGGCTGCTGATCCCTGG - Intergenic
1087227986 11:95625668-95625690 GAAAGGAGGCTGCTAGTTCCAGG + Intergenic
1087263826 11:96039994-96040016 GCGAATAGGCTGCTAGCCCCAGG - Intronic
1089528594 11:119112579-119112601 CCATGGTGGCTGCTGGTCCCAGG - Exonic
1089602332 11:119623658-119623680 GCAGGTGGGCAGCTGGCCCCAGG + Intronic
1091074846 11:132605908-132605930 GAAAGGAAGCTGCTGGTCACTGG - Intronic
1091765707 12:3118759-3118781 GAAATTAGGCTGCTGCTACCTGG - Intronic
1092738588 12:11607258-11607280 GCAAGGAGGCTGCTTATTCCAGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1103041101 12:117696207-117696229 CCAGGGAGGCTGCTGGGCCCCGG + Intronic
1103901831 12:124307397-124307419 GAGAGCAGGCTGCTGGTCACTGG - Intronic
1106548792 13:30753721-30753743 GGAAGTGGGCTGCTGGCACCAGG - Intronic
1106595267 13:31130026-31130048 GCAAGTGGGATGCTGCTTCCAGG - Intergenic
1112692780 13:101916223-101916245 GCAAGTTGGCTGCTCCTCGCCGG - Intronic
1115952437 14:38736264-38736286 GCAAGCAGGCTTCAGTTCCCAGG + Intergenic
1118001406 14:61526870-61526892 ACAAGGAGGCTGCAGGTCACGGG - Intronic
1119474072 14:74917128-74917150 GCACGCAGGCTTCTGCTCCCGGG - Intronic
1122164749 14:99813901-99813923 GCCAGGAGGTTGCTGGTGCCTGG + Intronic
1125092692 15:35812801-35812823 GCAAGCAGGCTGCTGGTCCAAGG + Intergenic
1125334178 15:38611520-38611542 GCACATAGGCTGCCGGTTCCTGG - Intergenic
1125719243 15:41837247-41837269 GCATGCTGGCTGCTGGCCCCGGG + Exonic
1128311534 15:66634166-66634188 GCAGGTAGCCTGCTGGGCCAAGG + Intronic
1128334461 15:66777284-66777306 GCAGGTAGGCTGCTGGGCTCAGG - Intronic
1128583725 15:68828571-68828593 GGAAGTAGGCAGGTGGTCACAGG + Intronic
1129845228 15:78765058-78765080 GCGATTTGGCTGCTGGTACCAGG - Intronic
1129873956 15:78960225-78960247 GCCAGCTGGCTGCAGGTCCCAGG + Exonic
1129977615 15:79835402-79835424 GCAGGTGTGCAGCTGGTCCCAGG - Intronic
1130256611 15:82328801-82328823 GCGATTTGGCTGCTGGTACCAGG + Intergenic
1130518739 15:84645986-84646008 GCTGGTTGGGTGCTGGTCCCTGG + Intronic
1130598340 15:85261187-85261209 GCGATTTGGCTGCTGGTACCAGG - Intergenic
1131238385 15:90717079-90717101 GGAAGTAGGCAGCTGGAACCCGG - Intergenic
1131506575 15:93025107-93025129 GCATGGAGGCTGCTGGGACCTGG + Exonic
1132457097 16:29987-30009 GAAAGGAGGCAGCTGCTCCCAGG - Intergenic
1134402253 16:13920638-13920660 CCGAGAAGGCTGCAGGTCCCTGG + Intronic
1135491873 16:22916401-22916423 GCAAGAAGGCAGCTGGTGCTGGG + Intergenic
1135610416 16:23861505-23861527 ACAAGGAGGCTGGTGGTTCCAGG + Intronic
1136654617 16:31702578-31702600 CCAAGGAGGCAGCTGGTCCTGGG - Intergenic
1136990199 16:35147301-35147323 GGAACTGGGCTGCTGGTCCTGGG + Intergenic
1136997719 16:35202169-35202191 GCAAGGAGGCTGAGGGTCCTTGG + Intergenic
1137619999 16:49869813-49869835 GGAAGAAGGCTGCAGGGCCCTGG + Intergenic
1144949499 17:18986380-18986402 ACAAGGAGGCTGCAGATCCCTGG - Intronic
1145018580 17:19413858-19413880 AAAAGTGGGCTGATGGTCCCAGG + Intronic
1148343222 17:46885988-46886010 GAAAGCAGCCTGCTGATCCCTGG + Intronic
1151666050 17:75545614-75545636 GCAGGGAGGCTGCTGGTATCTGG + Intronic
1152732391 17:81978662-81978684 GCCAGGAGGCTGTTGGTGCCAGG + Intronic
1152961085 18:80508-80530 GAAAGGAGGCAGCTGCTCCCAGG - Intergenic
1153991191 18:10402232-10402254 GCACCTAGGCTGCTGCTGCCTGG - Intergenic
1154338686 18:13485606-13485628 GCAAGTGGGCAGGTGATCCCAGG - Intronic
1159381760 18:67669006-67669028 GCAAGAAGGCTGCTGTCCACAGG + Intergenic
1162789415 19:13055314-13055336 GCAGGCAGGCTGCTGGGCCTGGG - Intronic
1163750343 19:19073289-19073311 GCAACCAGGCTGGGGGTCCCTGG - Intronic
1165434126 19:35787454-35787476 GTAAGTAGGGTGGGGGTCCCGGG - Exonic
1166276649 19:41758586-41758608 GCCAAGAGGCTCCTGGTCCCTGG + Intronic
926202957 2:10814336-10814358 CCAGGGAGGCTGCTTGTCCCGGG + Intronic
932200888 2:69827748-69827770 GCAAGTAGGAAGCTGGTTTCTGG + Intergenic
932571567 2:72941071-72941093 GCCAGGAGGCTTCTGGTCTCTGG - Intergenic
935901608 2:107799026-107799048 GAAAGTAGGCTCCTGGGCCAAGG - Intergenic
948130399 2:235596520-235596542 GCACCCCGGCTGCTGGTCCCTGG + Intronic
1168830866 20:844714-844736 GAAAGTAGGCAGCTGGACACCGG - Exonic
1169046568 20:2538109-2538131 GCCAGTAGGGAGCTGGCCCCAGG + Intronic
1169896254 20:10508211-10508233 CCAAGTAGGCTGATGCTCCAAGG - Intronic
1174452578 20:50629129-50629151 GGAGGTAGGCTGCTGGGGCCAGG + Intronic
1175956311 20:62611338-62611360 CCAGGCAGCCTGCTGGTCCCAGG - Intergenic
1176019326 20:62954483-62954505 GGAAGCAGGCTGCTGGGCTCAGG + Intronic
1178474736 21:32927803-32927825 AATAGTAGCCTGCTGGTCCCTGG - Intergenic
1179821019 21:43936947-43936969 AGAAGTAGGCTGTGGGTCCCTGG + Intronic
1180916788 22:19494406-19494428 GCAAGTGGGCTTCTGGTGCTGGG - Intronic
1182013740 22:27021945-27021967 GGGAGGATGCTGCTGGTCCCTGG + Intergenic
1182558526 22:31141751-31141773 GCAAGAAGGCGCTTGGTCCCTGG - Intergenic
1183673785 22:39288805-39288827 GCAAGTGGGCCGCTGGTACCAGG - Intergenic
950566485 3:13772565-13772587 GCATGGTGGCTGCTGCTCCCAGG + Intergenic
950765896 3:15272848-15272870 GGAAGTGGGCGACTGGTCCCAGG - Intronic
953276675 3:41508015-41508037 GCAGGGAGGCTGGTGGTCCAGGG + Intronic
953923631 3:46969026-46969048 GCAACCAGGCTGCTGGGCCTGGG + Intronic
955198617 3:56829377-56829399 ACAGGTAGGCTGCTGGAGCCAGG - Intronic
955585726 3:60475644-60475666 GCAAGTTGGCTGATTGGCCCAGG - Intronic
961067247 3:123885630-123885652 GCAAGTTGGCAGCTGATCCAGGG + Intergenic
964819464 3:160755022-160755044 GGGAGAAGGCTGCTGGACCCAGG + Intergenic
966899216 3:184468220-184468242 CCAAGTAGGATGCAGGTCACTGG - Intronic
969191652 4:5526181-5526203 GGAAGAAGGCTGGTGTTCCCAGG - Intronic
969227447 4:5808101-5808123 GCAGGGAGGCTGCTGATCCCTGG - Intronic
969732108 4:8963626-8963648 GCAAGGCGGCCGCGGGTCCCTGG + Intergenic
985892486 5:2726436-2726458 GAAACTGGGCTTCTGGTCCCAGG + Intergenic
986326422 5:6678584-6678606 CCCAGCAGGCTGCTGGTGCCAGG - Intergenic
988708880 5:33753926-33753948 GCAAGTAGGCTGCTGGTCCCAGG + Intronic
992778585 5:80108625-80108647 GCAAGAAGGCTGCTGGGCCTGGG + Intergenic
994098078 5:95865281-95865303 GGAAGTAGGCAGCAGATCCCAGG + Intergenic
997782554 5:136674959-136674981 CCTTGTTGGCTGCTGGTCCCAGG - Intergenic
998753082 5:145345982-145346004 GCTAGGAGTCTGCTGGTCCTAGG + Intergenic
1001924313 5:175625319-175625341 GCAAGGACGCTGTTGGGCCCAGG - Intergenic
1007239348 6:40413900-40413922 GCCAGTAGGCTGATGGTTCCGGG + Intronic
1007670547 6:43549470-43549492 GCTGGTAAGCTGCTGGACCCTGG - Exonic
1007742961 6:44023935-44023957 GGCAGCAGGCAGCTGGTCCCTGG + Intergenic
1009307021 6:62103276-62103298 ACATGTAGTCTGCTGGGCCCCGG + Intronic
1018143558 6:160863116-160863138 CTAAGGAGGCTGCCGGTCCCTGG - Intergenic
1019105773 6:169665502-169665524 GAAAGCAGGCAGCTGGTCACCGG - Exonic
1019543215 7:1560688-1560710 GCAGGTTGGCTGCAGGTCTCTGG + Intronic
1022795302 7:33727170-33727192 CCAAGGATGCTGTTGGTCCCAGG - Intronic
1023684044 7:42717071-42717093 ACTAGGAGGCTGCTGGTCACAGG - Intergenic
1026314991 7:69220341-69220363 GCAGCTAGGCTGATGGCCCCAGG + Intergenic
1040510110 8:48085692-48085714 ACAAGGATGCTGCTGGTCTCAGG - Intergenic
1049753129 8:144295068-144295090 GCAGGGAGGCTGCGGGTCCCGGG - Intronic
1057497241 9:95570999-95571021 GCAAGGAGGCAGCTTGTTCCTGG - Intergenic
1059281117 9:113135064-113135086 GCACTGATGCTGCTGGTCCCTGG - Intergenic
1059385832 9:113963574-113963596 GCAAGTACTCTGCTGGGCTCTGG - Intronic
1060899065 9:127241574-127241596 GCATGTGGCCTGCTGGGCCCAGG + Intronic
1060926315 9:127457666-127457688 GCGAGGAGACTGATGGTCCCAGG + Intronic
1061715669 9:132517276-132517298 GCCAGCAGTCTGCTGCTCCCGGG - Intronic
1062228465 9:135467265-135467287 GCAAGGAGGCAGCTGGAGCCAGG + Intergenic
1062629844 9:137458772-137458794 GCCGGTCGGCTGCTGTTCCCCGG + Intronic
1062737075 9:138143478-138143500 GAAAGGAGGCAGCTGCTCCCAGG + Intergenic
1187265176 X:17725767-17725789 CAAAGTAGGCTGGTGGTCCTGGG - Exonic
1188572741 X:31608683-31608705 CCATCTAGGCTGCTGGTCTCAGG - Intronic
1189163575 X:38836307-38836329 GCAAGTATGGTGGTGCTCCCAGG + Intergenic
1191772820 X:64781300-64781322 GCTAGTGGGCTGCTGGTACTAGG + Intergenic
1193337542 X:80307824-80307846 GCAAGCAGGCTGCAGCTGCCAGG + Intergenic
1195753196 X:108177347-108177369 GCAAGTAGGCTCCAGTTTCCTGG + Intronic
1197140031 X:123107451-123107473 CCATGTTGGCTGTTGGTCCCTGG - Intergenic
1199934946 X:152563600-152563622 GGAGGTAGTGTGCTGGTCCCAGG + Intergenic
1200399262 X:156009739-156009761 GAAAGGAGGCAGCTGCTCCCAGG + Intronic