ID: 988712052

View in Genome Browser
Species Human (GRCh38)
Location 5:33788564-33788586
Sequence CGCCAACTCACTTGAATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988712052_988712056 -8 Left 988712052 5:33788564-33788586 CCAGGAATTCAAGTGAGTTGGCG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 988712056 5:33788579-33788601 AGTTGGCGAGGAAAGGAATAGGG 0: 1
1: 0
2: 0
3: 17
4: 188
988712052_988712059 29 Left 988712052 5:33788564-33788586 CCAGGAATTCAAGTGAGTTGGCG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 988712059 5:33788616-33788638 ACACTGGAAGCAGGTGCACCAGG 0: 1
1: 0
2: 1
3: 23
4: 209
988712052_988712058 20 Left 988712052 5:33788564-33788586 CCAGGAATTCAAGTGAGTTGGCG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 988712058 5:33788607-33788629 TGAAGAGAAACACTGGAAGCAGG No data
988712052_988712057 13 Left 988712052 5:33788564-33788586 CCAGGAATTCAAGTGAGTTGGCG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 988712057 5:33788600-33788622 GGCATGATGAAGAGAAACACTGG 0: 1
1: 0
2: 1
3: 23
4: 297
988712052_988712055 -9 Left 988712052 5:33788564-33788586 CCAGGAATTCAAGTGAGTTGGCG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 988712055 5:33788578-33788600 GAGTTGGCGAGGAAAGGAATAGG 0: 1
1: 0
2: 1
3: 16
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988712052 Original CRISPR CGCCAACTCACTTGAATTCC TGG (reversed) Intronic
902240032 1:15082233-15082255 AGCCACCTCACTTGACCTCCAGG + Intronic
904416353 1:30363213-30363235 TGACAGCTGACTTGAATTCCTGG - Intergenic
905151246 1:35930129-35930151 CCCCACCTCACTTGAATGTCAGG - Intergenic
905801054 1:40843092-40843114 CACCAGCTCCCTTGGATTCCTGG + Intergenic
906568214 1:46815339-46815361 CGCCACCTCACCTGATTTCCAGG - Intronic
909956511 1:81785847-81785869 CTCCAAATCACTGGAATTACAGG - Intronic
915389364 1:155527504-155527526 CGCTACCTCACTTGACTTACGGG + Intronic
920724873 1:208425348-208425370 CGCTAACTCCCTACAATTCCAGG - Intergenic
923924544 1:238609878-238609900 CACCACCTCACTTAAATTTCTGG - Intergenic
1075490178 10:122859922-122859944 AGACAACTGTCTTGAATTCCTGG + Intronic
1079132887 11:17759257-17759279 CTCTAACTCTCTTGAATTCTAGG - Intronic
1080379515 11:31753473-31753495 TGCCAACTTACTTGACTCCCAGG - Intronic
1083931501 11:65848750-65848772 ATCCAACTCACTTGAAGCCCTGG + Intronic
1087816759 11:102666359-102666381 CTCCCACTCCCTTGAATTTCGGG + Intergenic
1090752419 11:129759207-129759229 TGCCGACTCACTTGAATCCCTGG - Intergenic
1090832597 11:130429402-130429424 TGCCACCTTACTTGAAGTCCCGG - Intergenic
1092791560 12:12075244-12075266 TCCCAACTCACTGGAATTACAGG + Intronic
1100016032 12:90011943-90011965 AGCAAATGCACTTGAATTCCTGG - Intergenic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1107458828 13:40580938-40580960 CGCCTACACACTTAAATACCCGG + Intronic
1112104116 13:96221742-96221764 CTCCAACTATCTAGAATTCCAGG - Intronic
1114241076 14:20868960-20868982 ATGCATCTCACTTGAATTCCAGG + Intergenic
1116950001 14:50870826-50870848 CTTGAACTCACTTGAACTCCTGG - Intronic
1119670078 14:76511682-76511704 TGACAACTCTCTTGAAGTCCGGG - Intergenic
1136989894 16:35145653-35145675 TGCCAACTCACGTGCATTCTGGG - Intergenic
1138036384 16:53611158-53611180 TGCCACCTCACTTGCATGCCTGG + Intronic
1140160128 16:72481620-72481642 CCCCAACTCTCCTTAATTCCTGG - Intergenic
1142261170 16:89043069-89043091 CGCCACCTCACGGGAATTCCAGG - Intergenic
1146409338 17:32568850-32568872 CACCTACTCACTGGAATTACAGG + Intronic
1150046801 17:61921270-61921292 AGCCCACTGGCTTGAATTCCTGG - Intronic
1153934983 18:9913648-9913670 CGCCCACTCACTACAACTCCCGG - Intergenic
1156872875 18:41967811-41967833 CACCAACTGCCTTGACTTCCAGG - Intronic
1160738624 19:676083-676105 CCCAAACCCACTTTAATTCCTGG + Intergenic
1163433961 19:17284067-17284089 CTCCATCTCCCTTGACTTCCAGG + Exonic
1166071013 19:40387957-40387979 CCCCAACTAACTGGGATTCCAGG + Intronic
928963417 2:36953214-36953236 CCCCAGCTCACCTTAATTCCAGG + Intronic
942034578 2:171998476-171998498 TGCAAACTCATTTCAATTCCAGG - Intronic
948063623 2:235060726-235060748 TGCCATCTCCCTTGAATTTCAGG - Intergenic
1174335171 20:49854534-49854556 CGTCACCTCAATTGATTTCCTGG + Intronic
958053315 3:88377066-88377088 GGCCAACTCACTTGATATCTTGG + Intergenic
959081413 3:101805511-101805533 CTTCAGCTCACTTGACTTCCTGG + Intronic
963147979 3:142014401-142014423 CGCCAAAGCACTGGGATTCCAGG + Intronic
971403640 4:26300151-26300173 GGCCAAATCACTTGAATTTTGGG + Intronic
985324440 4:188752211-188752233 CACCATCTCACTTGAATTATGGG + Intergenic
985814351 5:2115497-2115519 CCCCAGCTCACCTGAATTACAGG + Intergenic
986134521 5:4962444-4962466 CTACAACTCACTGGAAGTCCTGG + Intergenic
988712052 5:33788564-33788586 CGCCAACTCACTTGAATTCCTGG - Intronic
994466346 5:100138170-100138192 CATCAAATCACTTGAAGTCCAGG - Intergenic
995248198 5:109959820-109959842 CGTCAGCTCACTTGAACTGCAGG - Intergenic
995921422 5:117318677-117318699 AGGGAAGTCACTTGAATTCCAGG - Intergenic
996163263 5:120193870-120193892 GGGCAACTCACTTGAACTTCTGG - Intergenic
997398434 5:133582754-133582776 TTCCAACCCACTTGAATGCCAGG + Intronic
998013922 5:138717351-138717373 CGCTCACACACTTCAATTCCTGG - Intronic
1017067841 6:150546721-150546743 GGCCAACACAATTGACTTCCTGG + Intergenic
1028756484 7:94440858-94440880 CGCCTGGTCATTTGAATTCCAGG + Intergenic
1031498414 7:122481307-122481329 CAACAACTGACTTGTATTCCAGG - Intronic
1041233297 8:55774274-55774296 CGCCAAGAGACTTGAATTCTAGG + Intronic
1042512135 8:69623170-69623192 AGCCAACTCACTTTTATACCTGG - Intronic
1044107896 8:88234960-88234982 GTCCAACTCCCTTGAATTCTAGG + Intronic
1050522083 9:6511500-6511522 GGCCAACTAAATTCAATTCCAGG - Intergenic
1053323338 9:37119947-37119969 CTCCAACTCTCTGGAATTCTAGG - Intergenic
1055324206 9:75111590-75111612 CCTTAACTCAGTTGAATTCCAGG + Intronic
1059624066 9:116042168-116042190 CACCTACTCACTTCACTTCCTGG + Intergenic
1186735423 X:12458374-12458396 CCCCAACTCACTGGGATTCATGG + Intronic
1192748635 X:73964887-73964909 TGGCAACTCTCTTGAAATCCAGG + Intergenic
1199234310 X:145472536-145472558 CGCCAGCCAACTTGAATCCCAGG - Intergenic