ID: 988713257

View in Genome Browser
Species Human (GRCh38)
Location 5:33799588-33799610
Sequence GGGCATTATACCCATTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988713251_988713257 12 Left 988713251 5:33799553-33799575 CCTTATTTGGCTTTGAATCTCAT 0: 1
1: 0
2: 0
3: 17
4: 257
Right 988713257 5:33799588-33799610 GGGCATTATACCCATTGGCTGGG No data
988713249_988713257 14 Left 988713249 5:33799551-33799573 CCCCTTATTTGGCTTTGAATCTC 0: 1
1: 0
2: 0
3: 16
4: 273
Right 988713257 5:33799588-33799610 GGGCATTATACCCATTGGCTGGG No data
988713250_988713257 13 Left 988713250 5:33799552-33799574 CCCTTATTTGGCTTTGAATCTCA 0: 1
1: 0
2: 1
3: 30
4: 274
Right 988713257 5:33799588-33799610 GGGCATTATACCCATTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988713257 Original CRISPR GGGCATTATACCCATTGGCT GGG Intronic
No off target data available for this crispr