ID: 988726309

View in Genome Browser
Species Human (GRCh38)
Location 5:33929905-33929927
Sequence CTTCACTTGCAGAATGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988726304_988726309 -2 Left 988726304 5:33929884-33929906 CCCGTGTCTGTTTGTAGTTTCCT No data
Right 988726309 5:33929905-33929927 CTTCACTTGCAGAATGGGCTCGG No data
988726303_988726309 10 Left 988726303 5:33929872-33929894 CCAAAGGTACAACCCGTGTCTGT No data
Right 988726309 5:33929905-33929927 CTTCACTTGCAGAATGGGCTCGG No data
988726305_988726309 -3 Left 988726305 5:33929885-33929907 CCGTGTCTGTTTGTAGTTTCCTT No data
Right 988726309 5:33929905-33929927 CTTCACTTGCAGAATGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988726309 Original CRISPR CTTCACTTGCAGAATGGGCT CGG Intergenic
No off target data available for this crispr