ID: 988727383

View in Genome Browser
Species Human (GRCh38)
Location 5:33938244-33938266
Sequence CCATTTAAGAAGTAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988727363_988727383 25 Left 988727363 5:33938196-33938218 CCCCGGGCGGTAAAGAGGTGAAA 0: 1
1: 0
2: 0
3: 1
4: 46
Right 988727383 5:33938244-33938266 CCATTTAAGAAGTAGGTGGGAGG 0: 1
1: 0
2: 2
3: 12
4: 196
988727365_988727383 23 Left 988727365 5:33938198-33938220 CCGGGCGGTAAAGAGGTGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 143
Right 988727383 5:33938244-33938266 CCATTTAAGAAGTAGGTGGGAGG 0: 1
1: 0
2: 2
3: 12
4: 196
988727364_988727383 24 Left 988727364 5:33938197-33938219 CCCGGGCGGTAAAGAGGTGAAAG 0: 1
1: 0
2: 0
3: 5
4: 107
Right 988727383 5:33938244-33938266 CCATTTAAGAAGTAGGTGGGAGG 0: 1
1: 0
2: 2
3: 12
4: 196
988727362_988727383 29 Left 988727362 5:33938192-33938214 CCTTCCCCGGGCGGTAAAGAGGT 0: 1
1: 0
2: 0
3: 4
4: 37
Right 988727383 5:33938244-33938266 CCATTTAAGAAGTAGGTGGGAGG 0: 1
1: 0
2: 2
3: 12
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988727383 Original CRISPR CCATTTAAGAAGTAGGTGGG AGG Intergenic
900007035 1:65559-65581 CCAGTTATGAAGAAGGTAGGTGG + Intergenic
905120334 1:35676933-35676955 GCATTTAAAGGGTAGGTGGGAGG + Intergenic
905457913 1:38100968-38100990 CCATTTAATATGAAGGTGGTGGG + Intergenic
906735385 1:48121196-48121218 CCATTTAAGAGGTAGGAGCTTGG - Intergenic
906935632 1:50211798-50211820 CCTTTTAAAAGGGAGGTGGGAGG + Intergenic
907111067 1:51926771-51926793 CCATGTAAGTAGTAGATGGCAGG - Intronic
907567453 1:55449098-55449120 ACACTTAAGAAGTGGGTGGGTGG - Intergenic
910104305 1:83614580-83614602 TGGTTTAAGAAGTAAGTGGGAGG + Intergenic
910375547 1:86565867-86565889 CAATTTTAGAAGTACATGGGAGG + Exonic
911440652 1:97921438-97921460 CCATCCACCAAGTAGGTGGGCGG + Intergenic
913263948 1:117026216-117026238 CCATTGGAGAAGTAGGGGTGTGG + Intronic
914959751 1:152196063-152196085 CCATCCAAGAGGGAGGTGGGGGG - Intergenic
915372140 1:155360188-155360210 GCCATTAAGAAGTATGTGGGAGG - Intronic
916812523 1:168317993-168318015 CCATCTAATAAGTATGTAGGAGG - Intergenic
917112838 1:171568550-171568572 CCATTTAAGATGAAGGTTTGTGG + Intronic
917268073 1:173242984-173243006 CCAGGTAAGAAGTTGGTGGGTGG + Intergenic
918152753 1:181812486-181812508 CCAGTGAAGATGGAGGTGGGTGG - Intergenic
921198184 1:212779364-212779386 CCATCTCAGAGGGAGGTGGGGGG + Intronic
922304611 1:224333223-224333245 GCCTTTAAGAAGGAGGTGGCTGG - Intergenic
922791152 1:228311813-228311835 CCATCTGAGAAGTGGGTGGGAGG + Intronic
923567005 1:235083789-235083811 TCAGTTAGGAAGGAGGTGGGTGG + Intergenic
924655771 1:245974250-245974272 CCATCTAAGGAGTAGGTTTGGGG - Intronic
924738703 1:246781835-246781857 CCATTAAATAAGAATGTGGGGGG + Intergenic
924866227 1:247984189-247984211 CCAGTTAAGTAGGAGGTGGGGGG + Intronic
1064456110 10:15488831-15488853 CCGTTTCAGAGGCAGGTGGGAGG - Intergenic
1065025251 10:21534626-21534648 CCATCTAAGAGGGAGTTGGGGGG - Exonic
1065144511 10:22754734-22754756 CCATTTAAGAAGGATGTTGCTGG - Intergenic
1066050260 10:31628132-31628154 ATATTTAAGAAGTAGGGGTGTGG - Intergenic
1066067598 10:31773637-31773659 CAATACAAAAAGTAGGTGGGTGG - Intergenic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1070613820 10:77953407-77953429 GCATTGAAGAAATAGGTGGTGGG + Intergenic
1070957157 10:80471736-80471758 CCATTTGAGAAGTGGGGGTGGGG + Intronic
1071613269 10:87051333-87051355 ACATTTAAGAAGTAGGTGTGTGG - Exonic
1074060480 10:109960970-109960992 CAATTTAAGAACTAGGTGAATGG - Intergenic
1074356103 10:112784872-112784894 CCTTTTAAAAAGTCAGTGGGAGG - Intronic
1075613326 10:123871096-123871118 ACATTTAAGAAGGAGGTAGGTGG - Intronic
1077668735 11:4137952-4137974 CCATCTGGGAAGGAGGTGGGGGG - Intronic
1079012995 11:16845118-16845140 CCATTTAAGTAATAGCAGGGAGG + Intronic
1079301934 11:19286068-19286090 TCAGGTCAGAAGTAGGTGGGAGG + Intergenic
1079738663 11:24030190-24030212 CTATTTAAGAACTATTTGGGTGG + Intergenic
1079777431 11:24549995-24550017 CCATTTCAGAAGAGGGTGGTGGG - Intronic
1081548855 11:44094166-44094188 CCATTTGAGAACTGGATGGGTGG - Intergenic
1083387692 11:62324039-62324061 GCATCTAAAAAGTTGGTGGGTGG - Intergenic
1085810532 11:79676820-79676842 ACATGTGAGAAGTAGGTTGGGGG + Intergenic
1089279183 11:117360913-117360935 CCATATAAGAAGGATGCGGGAGG - Intronic
1090007851 11:123018599-123018621 CCATTGAAGAAGAAGTTGTGAGG - Intergenic
1090334120 11:125951280-125951302 CCATGTAACAAGGAGGTGGGCGG + Intergenic
1090793379 11:130112077-130112099 CTATTTAAGAAGTAAGTATGAGG - Intronic
1092926419 12:13276300-13276322 CCTTTTGGGAAGTGGGTGGGTGG + Intergenic
1093532639 12:20185807-20185829 ACGTTTAAGAAGAAGGTAGGAGG + Intergenic
1093778844 12:23110540-23110562 CCATTTGTGAAGTAGGTGTGTGG - Intergenic
1095422521 12:42040089-42040111 CCATCTCAGAAGTAGGGGTGGGG + Intergenic
1096367079 12:51037161-51037183 CCTTTAAAGAAGCAAGTGGGGGG - Intergenic
1096860415 12:54523243-54523265 CCATTAAAGAAAGAGGTGTGTGG + Intronic
1096986256 12:55760196-55760218 ACACTTAAGAAGTAGGTGGGTGG + Intronic
1098965522 12:76783815-76783837 CCATATAAGAGGGAGGTGGAGGG + Intronic
1099397827 12:82163043-82163065 TCCTTTAAGAAGCAGGTGGAGGG - Intergenic
1101751267 12:107584483-107584505 TCATTTTAGAAGTTGCTGGGTGG + Intronic
1101875046 12:108592127-108592149 CCATCCAGGAAGTTGGTGGGGGG + Exonic
1107043958 13:35975960-35975982 CCATTGAGGAAATAGGTCGGAGG - Intronic
1108499418 13:51056046-51056068 CCATTTAGGAGAGAGGTGGGTGG - Intergenic
1108785154 13:53891477-53891499 CAATTTAAGAAGTGGCTGGGAGG + Intergenic
1109424282 13:62150982-62151004 CCCTTTAAGCTGTAGGTGGAGGG + Intergenic
1110255229 13:73426124-73426146 CTATTTAAAAAGAAGGTTGGGGG - Intergenic
1113568496 13:111336422-111336444 CAATTTAAGAAGTTGGTGAAAGG - Intronic
1118528938 14:66679723-66679745 GCAATTAAGCAGTTGGTGGGTGG - Intronic
1118691829 14:68347383-68347405 GACTTTAAGAAGTAGGTGGCTGG + Intronic
1121288917 14:92758643-92758665 CCATTTCAGAAGAAGGAGTGTGG - Intergenic
1121310634 14:92933389-92933411 CCATTTATGAAGTAGGGGTAAGG + Intronic
1121778357 14:96605893-96605915 ACATTTGAGAAGTGGCTGGGTGG - Intergenic
1121794932 14:96726931-96726953 CCATGAGAGAAGTAGGTGGTGGG + Intergenic
1122214045 14:100192095-100192117 CCACTTCGGAAGTGGGTGGGTGG - Intergenic
1122887984 14:104719032-104719054 GCCTTTAGGAAGCAGGTGGGAGG - Exonic
1126944963 15:53809322-53809344 CCATTAAAAAGGTGGGTGGGAGG - Intergenic
1126968031 15:54077665-54077687 CAATTTGAGAAGTAGTTGGCCGG - Intronic
1127331760 15:57946850-57946872 CCATGTCAGCATTAGGTGGGTGG + Intergenic
1128179275 15:65587314-65587336 CCATTTATGAAGCAGGAGGATGG + Intronic
1128633532 15:69288284-69288306 CCTTTTAAGAAGGAGGCAGGAGG - Intergenic
1129155876 15:73717500-73717522 CCATTTAAAAAGAACGAGGGAGG - Intergenic
1129303660 15:74642341-74642363 ACATTTCAGAAAGAGGTGGGAGG - Intronic
1129366685 15:75060089-75060111 CCATTTAAGAAATAAGAGGCTGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130752485 15:86726990-86727012 ACAGTTAAGAAGTCAGTGGGAGG + Intronic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1134430846 16:14204334-14204356 CCATTTAAGAAGCAGGGGAAAGG + Intronic
1135884651 16:26295045-26295067 CCTTTTAAGAGGGAGGCGGGAGG - Intergenic
1137547500 16:49414639-49414661 TCATTTAAGGAGAAAGTGGGGGG - Intergenic
1138463062 16:57164728-57164750 CCATTTAAGACTTATGTGGGAGG + Intronic
1139222173 16:65194708-65194730 CCTGTTAAGAAGTGGGTGAGTGG - Intergenic
1142953938 17:3507363-3507385 CCATTTAAGATGGTGGTAGGAGG - Intronic
1146989100 17:37251071-37251093 GCATTTTAAAAGGAGGTGGGTGG + Intronic
1150453257 17:65287145-65287167 CGATTTAAGATGTGGGTGGCTGG - Intergenic
1150953180 17:69824864-69824886 CCATTTTAGAAGTTGGAGGAGGG + Intergenic
1151403581 17:73872267-73872289 CCATGGAGGAAGTTGGTGGGGGG - Intergenic
1155533255 18:26789440-26789462 CCATTAATAAAGTGGGTGGGAGG + Intergenic
1157929586 18:51806758-51806780 CCACTTAAGAGTTAGGTGGATGG + Intergenic
1158957363 18:62552600-62552622 CCAATTAAAAAGTAAGTGGCTGG + Intronic
1160638790 19:107143-107165 CCAGTTATGAAGAAGGTAGGTGG + Intergenic
1160705200 19:526313-526335 CCGTTTAAGAGGGCGGTGGGGGG - Intergenic
1168457909 19:56528492-56528514 CCACTTGAGAATGAGGTGGGAGG - Exonic
927640989 2:24845311-24845333 CCATTTAACAAGTCTCTGGGAGG - Intronic
929011333 2:37447927-37447949 CCAGCTAATAAGTAGGTGTGTGG + Intergenic
930416952 2:51101065-51101087 CCACTTAAGATATAGGTGGCTGG - Intergenic
934070495 2:88379690-88379712 CCATTTAAAAATTGGGTTGGGGG - Intergenic
937666709 2:124496025-124496047 CCATGTAAGCTCTAGGTGGGCGG + Intronic
939743554 2:145940202-145940224 CCAAATAAGAAGGAGGAGGGAGG - Intergenic
944315636 2:198282824-198282846 TAATTTAAAGAGTAGGTGGGAGG + Intronic
945683148 2:212937516-212937538 CCTTGTAAGAGGGAGGTGGGAGG + Intergenic
948711820 2:239829928-239829950 CCATTCTAAAAGTAGGTAGGTGG - Intergenic
1176033824 20:63026766-63026788 CCATTTAAGGAGCAGGTTGAAGG + Intergenic
1179371438 21:40809546-40809568 GCATTTCAGAAGTAGGTAAGTGG + Intronic
1181376132 22:22459711-22459733 CTTTTTGAGGAGTAGGTGGGTGG - Intergenic
949318390 3:2782276-2782298 CCATTTAGATGGTAGGTGGGGGG + Intronic
950371233 3:12532389-12532411 ACATTTCAGAAACAGGTGGGCGG - Intronic
953728308 3:45420543-45420565 TCATTTAAGAAATTGTTGGGGGG - Intronic
954421812 3:50422853-50422875 CTACTTATGAAGTGGGTGGGGGG + Intronic
956606622 3:71079255-71079277 CCAGTTGAGACCTAGGTGGGGGG - Intronic
957823711 3:85412883-85412905 CCATTTGAGAAGTCATTGGGAGG + Intronic
958054862 3:88396403-88396425 CCCTTAAAGAAGTAGGTAGTCGG - Intergenic
960090830 3:113636457-113636479 GCATTTAAAAAAAAGGTGGGGGG + Intergenic
962372790 3:134834620-134834642 TCATCTAAGAAGTAGCTGGAGGG - Intronic
962392154 3:134981679-134981701 ACATTTGATAAGTGGGTGGGTGG - Intronic
964626509 3:158764941-158764963 CCATGTAAGAAGTGGTTGGTTGG - Intronic
964798185 3:160522752-160522774 CTATTTAAGAAGTTGCTGGCCGG - Intronic
964834345 3:160920702-160920724 CCCTTTTAGCAGTAGGAGGGTGG + Intronic
967044528 3:185724508-185724530 TCAGTTAATAAGTAGCTGGGTGG - Intronic
967799895 3:193645065-193645087 ATATTAAAGAAGAAGGTGGGAGG + Intronic
967971072 3:194999867-194999889 CTAGTGAAGAAGTAGTTGGGTGG - Intergenic
968299906 3:197604530-197604552 TTATTTAAGATGTAGGTAGGTGG + Intergenic
969707330 4:8819049-8819071 CCAGTTAAGAAGGCGGAGGGTGG + Intergenic
969707350 4:8819114-8819136 CCAGTTAAGAAGGCGGAGGGCGG + Intergenic
971193586 4:24450583-24450605 CCAGTTAAAAAAAAGGTGGGGGG + Intergenic
972835448 4:42864824-42864846 ACAAATAAAAAGTAGGTGGGAGG - Intergenic
975245180 4:72112234-72112256 CACTTTAAGAAGTGGGAGGGAGG + Intronic
975328849 4:73091108-73091130 CCATTTTAGGAGTAGGCTGGGGG + Exonic
975330251 4:73104738-73104760 CTATTTAAGCGGGAGGTGGGGGG + Intronic
980481150 4:133389240-133389262 TCCTGTAAGAATTAGGTGGGAGG + Intergenic
981788091 4:148503338-148503360 AAAATTAAGAATTAGGTGGGGGG - Intergenic
982063276 4:151625707-151625729 TCTTTTAAAAAGGAGGTGGGTGG - Intronic
983890901 4:173028928-173028950 TCATTTAAAAAGTGAGTGGGTGG + Intronic
984633920 4:182090922-182090944 CCATTTTAGAAGTAGGACAGAGG - Intergenic
985490360 5:175317-175339 TCAGTGAAGAAGTCGGTGGGGGG - Intronic
988727383 5:33938244-33938266 CCATTTAAGAAGTAGGTGGGAGG + Intergenic
988782986 5:34540591-34540613 TCATTTGAGAAGTGGGTGGTCGG - Intergenic
989827570 5:45876382-45876404 TCAATTAATAATTAGGTGGGTGG + Intergenic
990582813 5:57181588-57181610 ACATTTAAAAAAAAGGTGGGGGG + Intronic
993010766 5:82479593-82479615 TCATTTTAGAAATAGGTGGTGGG + Intergenic
993317286 5:86426966-86426988 TTATTTAAAAATTAGGTGGGAGG - Intergenic
993346896 5:86795280-86795302 ATATTTAATAAGTTGGTGGGAGG + Intergenic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
996107644 5:119523270-119523292 GCATATTAAAAGTAGGTGGGAGG - Intronic
997413150 5:133705427-133705449 CCATTCCAGAAGGAGGTGTGTGG - Intergenic
997664171 5:135615262-135615284 CCATTTAACAAGTCTCTGGGAGG - Intergenic
999115695 5:149161358-149161380 CCATGGAGGAAGTAGGTGGAGGG - Intronic
999153783 5:149443732-149443754 CCTTTTCAGAAGTGGGTGGGAGG - Intergenic
999201839 5:149822239-149822261 CCATTTTCTGAGTAGGTGGGGGG - Intronic
1000168916 5:158682386-158682408 ACATTTAGGAAGTATTTGGGGGG - Intergenic
1001030152 5:168256723-168256745 CCATTTAAGAAACAGGTTTGAGG - Intronic
1001490610 5:172152149-172152171 CCAGTGAAGAAGTAGATGAGAGG - Intronic
1002231927 5:177772228-177772250 CCATAAAAGAAATAAGTGGGGGG + Intronic
1003801102 6:9668416-9668438 CCAATTCAGCAGGAGGTGGGTGG + Intronic
1005969701 6:30751522-30751544 CCAGCTAAAATGTAGGTGGGAGG - Intergenic
1008616520 6:53231678-53231700 CCATTAAAAAAGAAGGTGGAAGG + Intergenic
1008760632 6:54847840-54847862 ACACTTAAGAAGAAGGTGTGCGG + Intronic
1012576303 6:100804224-100804246 AAATTTAAAAAGTAGGTGTGTGG + Intronic
1013793767 6:113860946-113860968 CCATATATGAAGGAGATGGGTGG + Exonic
1015025396 6:128526163-128526185 CCCCCTCAGAAGTAGGTGGGAGG - Intergenic
1017361643 6:153579466-153579488 AGATTCAAGCAGTAGGTGGGAGG + Intergenic
1018112412 6:160548199-160548221 CCATTTTAGAATAAGGTGAGTGG + Intronic
1018130857 6:160731472-160731494 CCATTTTAGAACAAGGTGAGTGG - Intronic
1021786683 7:24159301-24159323 CCATTTAAGAAGGATGTGTCCGG + Intergenic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1024633697 7:51269374-51269396 CCAGGTAAGAAGGAGATGGGAGG + Intronic
1026562615 7:71462996-71463018 CCACTGAACAAGTAGATGGGAGG + Intronic
1029437650 7:100572059-100572081 CCCTTTAATGAGTGGGTGGGTGG - Intergenic
1029886282 7:103875641-103875663 TCATTTAAGAAGTAAGTCGTAGG - Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1033577771 7:142702530-142702552 CCATCTAGGAAGGAGATGGGTGG + Intergenic
1033651970 7:143350671-143350693 CCATTTGAGCAGCAGGAGGGAGG + Intronic
1033771944 7:144562374-144562396 CCAATTAAGAAGTAGGTCATGGG + Intronic
1035261514 7:157664519-157664541 CACTTTGGGAAGTAGGTGGGAGG + Intronic
1041958482 8:63583727-63583749 CCTTTTAAGAAGGAGGGGGGTGG + Intergenic
1042316918 8:67435169-67435191 CCATGGAAGAAGTAGGGGGTTGG + Intronic
1043525122 8:81088136-81088158 CCTTTTAGGAAGGAGTTGGGAGG - Intronic
1043958502 8:86389836-86389858 CCATCTGGGAAGGAGGTGGGGGG - Intronic
1044166247 8:88987565-88987587 CCTTTTAAGAAGTAGCTTAGAGG - Intergenic
1044761517 8:95522544-95522566 CCATTTAAGAGGTGGGTGCAAGG - Intergenic
1045483773 8:102614137-102614159 CCATTTTAGAAGTAGCTCAGAGG + Intergenic
1046355847 8:113083811-113083833 ACATTTAAAAATTAGCTGGGTGG + Intronic
1052161229 9:25262390-25262412 CCTTTTAAGAGGAAGGTGTGAGG + Intergenic
1052473810 9:28932766-28932788 AAATTTGAGAAGTAGCTGGGTGG - Intergenic
1056227148 9:84506663-84506685 CCATTCAAGAAGGAGGCAGGAGG + Intergenic
1203364283 Un_KI270442v1:243670-243692 CCACTGAAGAAGGCGGTGGGGGG - Intergenic
1186325435 X:8471653-8471675 CCATTTACAAAATTGGTGGGCGG + Intergenic
1187298293 X:18024003-18024025 TTATTTAACAAGGAGGTGGGTGG - Intergenic
1188464550 X:30464947-30464969 CCATTTAAGTAATAGGAGGCAGG - Intergenic
1189560902 X:42190542-42190564 CCAGTAAAGAAGTAGGTGATAGG - Intergenic
1189601776 X:42634619-42634641 ACATTTAAGAAGTCAGTGGAAGG - Intergenic
1189745415 X:44163319-44163341 GTCTTTAAGAAGTGGGTGGGTGG - Intronic
1189876993 X:45446811-45446833 CCATTTCAGGAGTAGCTGGCAGG + Intergenic
1190031088 X:46973782-46973804 CTATTTAAGAAATAGTTGGCCGG + Intronic
1190447368 X:50540679-50540701 CTATTTAAGAAGTAGTTGCTAGG + Intergenic
1193012499 X:76692593-76692615 CCATTTAAGAGGTTGGAAGGAGG - Intergenic
1194525169 X:94968933-94968955 CCATTTAACAAGTCTGTAGGAGG - Intergenic
1194697641 X:97074576-97074598 CCATTTAAGAAAAAGTTGGCAGG + Intronic
1196729429 X:118926176-118926198 CCATTTAAAAACTGGGTGGTTGG + Intergenic
1196965470 X:121049746-121049768 ACATTTAAGAAGAAGGTGTGTGG + Exonic
1199444236 X:147902278-147902300 CCATTTAAGAAGAAGTTGATAGG + Intergenic
1201074350 Y:10175591-10175613 CCACTGAAGAACGAGGTGGGGGG + Intergenic
1201478292 Y:14408815-14408837 CTATTTAAGAAAGAGGTGGCCGG + Intergenic