ID: 988728158

View in Genome Browser
Species Human (GRCh38)
Location 5:33944099-33944121
Sequence CCCTTGCCACCGAGGCATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988728146_988728158 23 Left 988728146 5:33944053-33944075 CCTGCCTCTTCCACCCTTGCACC No data
Right 988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG No data
988728150_988728158 9 Left 988728150 5:33944067-33944089 CCTTGCACCGAGATGCTGCCACC No data
Right 988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG No data
988728147_988728158 19 Left 988728147 5:33944057-33944079 CCTCTTCCACCCTTGCACCGAGA No data
Right 988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG No data
988728151_988728158 2 Left 988728151 5:33944074-33944096 CCGAGATGCTGCCACCCACACTT No data
Right 988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG No data
988728148_988728158 13 Left 988728148 5:33944063-33944085 CCACCCTTGCACCGAGATGCTGC No data
Right 988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG No data
988728149_988728158 10 Left 988728149 5:33944066-33944088 CCCTTGCACCGAGATGCTGCCAC No data
Right 988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG No data
988728152_988728158 -9 Left 988728152 5:33944085-33944107 CCACCCACACTTACCCCTTGCCA No data
Right 988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988728158 Original CRISPR CCCTTGCCACCGAGGCATAG AGG Intergenic
No off target data available for this crispr