ID: 988728425

View in Genome Browser
Species Human (GRCh38)
Location 5:33946525-33946547
Sequence CTCTGTTATAAGCACTGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988728425 Original CRISPR CTCTGTTATAAGCACTGCAT AGG Intronic
902625966 1:17676537-17676559 CTCTGCTCTGAGCTCTGCATAGG - Intronic
903316547 1:22512403-22512425 CTCTGTTACAGGCAGTGCACTGG - Intronic
905007350 1:34720652-34720674 ATCTGTGTTAAGCACTGCATGGG + Intronic
905721319 1:40205102-40205124 CTCTGTTATAACCACCCCATTGG + Intronic
905874027 1:41420966-41420988 CTCTGTGCTAAGCACTTCACAGG + Intergenic
905883446 1:41479128-41479150 CTCTGCTGGAAGAACTGCATGGG - Exonic
906141898 1:43538827-43538849 GTCTGTTAGAAGCACAGAATGGG + Intronic
907359062 1:53900224-53900246 CTCAGTTATAACAAATGCATGGG + Intronic
907808260 1:57842709-57842731 CACTGTCATAAGAACAGCATGGG + Intronic
910147545 1:84100231-84100253 CACTGTTATGAGAACAGCATGGG + Intronic
910257354 1:85260877-85260899 CTCTGTGACAAGCACTGCGCTGG - Intergenic
910505917 1:87950060-87950082 CTGAGTTCTAAGCACTGCGTAGG - Intergenic
911583640 1:99664515-99664537 TTCTGTGATAAACACTGTATGGG + Intronic
912042943 1:105415597-105415619 CACTGTCATAAGAACAGCATGGG - Intergenic
914384780 1:147157960-147157982 CTGTGTTATCAGCTTTGCATGGG + Exonic
918464225 1:184805641-184805663 GTCCACTATAAGCACTGCATGGG - Intronic
919473479 1:198007577-198007599 CACTGTTCTAAGCACTGTACTGG + Intergenic
920443350 1:205996892-205996914 CACTATTATAAGAACAGCATGGG + Intronic
922524845 1:226292983-226293005 TCCTGTTCTAAGCACTTCATAGG - Intronic
922797004 1:228345202-228345224 CTCGGTTATAAGGACTGAACTGG - Intronic
1064476457 10:15695220-15695242 CTCTGTTATAATCCCTGGATTGG - Intronic
1066169147 10:32822725-32822747 TTCTGTAATAAGCATTGAATTGG + Intronic
1076091622 10:127691527-127691549 CTCTGTGGTAAGGAGTGCATAGG + Intergenic
1078978460 11:16504766-16504788 CTCTATTACAAGAACAGCATGGG - Intronic
1079828170 11:25225722-25225744 CTCTGTCAAAAGAACAGCATCGG + Intergenic
1080236833 11:30079672-30079694 CACTGTTATAAGAACTGCAAGGG - Intergenic
1080307242 11:30849968-30849990 CTCTGTTCTAAGCACAGTGTGGG + Intronic
1080331371 11:31143596-31143618 CTCAGTTCTCAGCTCTGCATTGG + Intronic
1081635007 11:44715282-44715304 CACTGTCATAAGAACAGCATGGG + Intergenic
1082719783 11:56659824-56659846 CTTAGTGAGAAGCACTGCATGGG - Intergenic
1084300693 11:68249463-68249485 CACTGTCATAAGAACAGCATGGG - Intergenic
1087523453 11:99275406-99275428 CATTATTCTAAGCACTGCATAGG - Intronic
1092390618 12:8074435-8074457 CTCTGTGCTAAGCACTTCATTGG + Intergenic
1093116284 12:15215606-15215628 CTATGTTTTAAGCAATGAATGGG + Intronic
1097851585 12:64416009-64416031 CTCTCTTATACTCACTTCATTGG + Intronic
1097994109 12:65868951-65868973 CTCAGTTCTACGCAATGCATTGG - Intronic
1098659461 12:73074100-73074122 CTCTGTTATTTGCTCTGCAAAGG + Intergenic
1098743298 12:74201661-74201683 CACTGTCATAAGAACAGCATGGG + Intergenic
1098916581 12:76263108-76263130 CACTGTTCTAAGCACTTCACAGG + Intergenic
1099405004 12:82248710-82248732 CTCTATTATGAGAACAGCATGGG + Intronic
1099862371 12:88235764-88235786 CACTATTATGAGAACTGCATGGG + Intergenic
1100293650 12:93240062-93240084 CTCTATCATAAGAACAGCATGGG + Intergenic
1100913900 12:99395767-99395789 CTCTGTTATAATAAATTCATTGG + Intronic
1101325639 12:103713174-103713196 GTCTGTTCTAAGCACTTCACAGG - Intronic
1101676715 12:106923842-106923864 CTCTATCATAAGAACAGCATGGG + Intergenic
1102413248 12:112738570-112738592 CTCTGCCATCACCACTGCATGGG + Intronic
1106508593 13:30393266-30393288 CACTGTTATAAACTCTGCAATGG + Intergenic
1106637536 13:31544996-31545018 CCCTGTTATAAGCAATGTAGGGG + Intergenic
1107203276 13:37749044-37749066 CTCTATTACAAGAACAGCATGGG - Intronic
1109684768 13:65803819-65803841 ATGTGTTATTTGCACTGCATTGG - Intergenic
1111605168 13:90528910-90528932 CTCTTTTATAACCACTGAAAAGG + Intergenic
1112761829 13:102700384-102700406 ATCTGTTTTAAGGACTGGATTGG - Intergenic
1113265025 13:108607409-108607431 CACTGTCATGAGAACTGCATAGG - Intronic
1114767023 14:25384705-25384727 GTCTGTTATGAGGATTGCATGGG + Intergenic
1115298329 14:31856275-31856297 CACTGTTATGAGAACAGCATGGG + Intronic
1116549123 14:46211616-46211638 CTCTGTTATAAGAACAGCAAGGG - Intergenic
1116755426 14:48942098-48942120 CACTGTTACAAGAACAGCATGGG - Intergenic
1119968964 14:78948210-78948232 TCCTGCTCTAAGCACTGCATAGG + Intronic
1119992913 14:79219494-79219516 CTCTGTCATTAGCATTGCTTTGG + Intronic
1120229101 14:81823384-81823406 CACTGTTATGAGAACAGCATAGG + Intergenic
1120625657 14:86822922-86822944 CTCTGTTGTAAACACTGCGTTGG + Intergenic
1121150445 14:91628549-91628571 CACTGTTATGAGAACAGCATGGG - Intronic
1122503339 14:102216287-102216309 CTCTGTTCTTAGCACTGAACAGG + Intronic
1123023376 14:105412378-105412400 CTCTGTGCTGGGCACTGCATTGG - Exonic
1124072521 15:26409284-26409306 CTCTGTTCTAAGAACTTCACTGG + Intergenic
1124885143 15:33678299-33678321 CTCTATTATGAGAACAGCATGGG - Intronic
1126867263 15:52949973-52949995 CTCTGTTCAAAACACTGCAATGG + Intergenic
1127864202 15:63018669-63018691 CTCTGTAATAAACTCTGGATGGG - Intergenic
1128063897 15:64752372-64752394 CTCTGTTGAAATCACTGCAGGGG - Intronic
1128626680 15:69214360-69214382 CACTATTATAAGAAATGCATGGG - Intronic
1128816874 15:70616520-70616542 CACTGTTATGAGAACAGCATGGG + Intergenic
1129829446 15:78658882-78658904 CTCTGTTATAAACACTGCTCTGG + Intronic
1130026871 15:80277682-80277704 CTCTGTTATAAGAGATGAATGGG + Intergenic
1131615366 15:94011594-94011616 TTCTTTGATAATCACTGCATTGG + Intergenic
1131770149 15:95728472-95728494 CACTGTCATGAGAACTGCATGGG - Intergenic
1132918188 16:2366212-2366234 CTTTGTTCTAAGCACTTTATAGG - Intergenic
1133024664 16:2983173-2983195 CTCTGTGCTAAGCACTTCACAGG - Intergenic
1133947404 16:10360727-10360749 CTCTATCATAAGAACGGCATGGG - Intronic
1134784166 16:16925728-16925750 CACTGTCATAAGAACAGCATGGG - Intergenic
1135053128 16:19208520-19208542 CACTGTTATGAGAACAGCATGGG + Intronic
1135813926 16:25614732-25614754 CTCTGTGCTAAGCCCTGCAGAGG - Intergenic
1135822854 16:25699891-25699913 CTCTGTCACAAGCTCTACATAGG - Intronic
1135911411 16:26564892-26564914 CTTTGTTGAAAGCACTGCAATGG + Intergenic
1143282695 17:5766643-5766665 CCCTGTTACCAGCACAGCATGGG + Intergenic
1143568579 17:7740325-7740347 CTCTGTCCTCAGCAATGCATGGG + Intronic
1143575034 17:7787243-7787265 CTCTGTTGTAAGCACTGTGTAGG + Intronic
1146657067 17:34640795-34640817 CTCTCTTATAAGAACTCCAAGGG - Intergenic
1147027686 17:37602468-37602490 CTCAGTTATAAGCACTCCCTTGG - Intronic
1149087971 17:52742317-52742339 CTCTGATATAAACACTGCCCTGG - Intergenic
1149370084 17:55985306-55985328 CTCTGTCATGAGAACAGCATGGG + Intergenic
1149375647 17:56041538-56041560 CTCTTTTCTAGGCACTGGATGGG + Intergenic
1153619856 18:6967561-6967583 CACTGTTCTAAGAACTGCCTGGG - Intronic
1156948304 18:42862191-42862213 CTCTATCATAAGAACAGCATAGG - Intronic
1157159958 18:45304966-45304988 CTCTCTTACAAGCCCTGCAAGGG - Intronic
1159023456 18:63161988-63162010 CTGTGTTCTAAGAACTGCTTTGG - Intronic
1160241658 18:77129227-77129249 CTCTGTGAATAGCACTGCGTTGG - Intronic
1165186402 19:34025992-34026014 CTCTATTATAAGAACTTCACTGG - Intergenic
927906986 2:26865781-26865803 CTCAGTTGTAAGCAATGAATTGG + Intronic
928062944 2:28133486-28133508 CCCTGTCAAATGCACTGCATGGG - Intronic
928735155 2:34279978-34280000 CACTATTATAAGAACAGCATGGG + Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
930137137 2:47913814-47913836 CACTGTTCTAAGCACTTTATAGG - Intergenic
930275794 2:49309889-49309911 CCCTGTGATAAGTACTGCAAAGG + Intergenic
931667937 2:64623612-64623634 CTGTGTTCCAAGCACTCCATGGG - Intergenic
931679322 2:64730642-64730664 GTCTGCTATCACCACTGCATGGG + Intronic
936685646 2:114823310-114823332 CTCTGTCATGAGAACAGCATGGG + Intronic
939329405 2:140737964-140737986 CTCTGTTTTCATCTCTGCATTGG - Intronic
939662780 2:144911042-144911064 CTCTGTAACAAGCACTGGGTAGG + Intergenic
939803808 2:146748153-146748175 CACTATTATAAGAACAGCATGGG + Intergenic
942834385 2:180276722-180276744 TTCTGTTAGAAGTACTGCCTTGG + Intergenic
943087745 2:183333368-183333390 CTCAGTTAAAAGTACTTCATTGG - Intergenic
943256628 2:185602047-185602069 CACTGTCATAAGAACAGCATGGG + Intergenic
943373450 2:187045610-187045632 CACTGTTATGAGAACAGCATGGG - Intergenic
944416913 2:199488223-199488245 CTCTGTAATAAGTACTGTGTGGG - Intergenic
945623553 2:212171626-212171648 CACTATTATAAGAACAGCATGGG - Intronic
946740546 2:222796895-222796917 CTCTGTTGTAAACACTGTACTGG + Intergenic
947832540 2:233151747-233151769 CTCTGTGCTAAGCACTGTTTTGG - Intronic
1170049141 20:12122386-12122408 CTCTGTTATCAGCAATGCATGGG - Intergenic
1171888805 20:30687734-30687756 TTCTGGAATAAGCACTGTATTGG + Intergenic
1174987214 20:55468407-55468429 CATTGTTATGAGAACTGCATAGG - Intergenic
1177004087 21:15649163-15649185 TTCTGTTATATCCACTGCCTTGG - Intergenic
1178041229 21:28642881-28642903 GTCTTTTATAAGCACAGGATGGG + Intergenic
1182109850 22:27715346-27715368 CTCTTTTGAAAGCCCTGCATGGG + Intergenic
949887073 3:8704221-8704243 CACTTTTAAAAGCACTGTATTGG - Intronic
951826032 3:26869792-26869814 CTCTGTTCTAAGCACTTAGTGGG - Intergenic
955131806 3:56177164-56177186 CTCTGCTTTAAGAACTGCAATGG + Intronic
959669498 3:108959975-108959997 CTCTGTTATAGGCTCTCCATTGG - Intronic
967854600 3:194107131-194107153 CTCTCTTCTAACCACTGTATTGG - Intergenic
967937214 3:194738706-194738728 CTCTGTTGCCAGCACTGCACAGG + Intergenic
968976727 4:3825984-3826006 CTGTGTTATAACCGCTGCACAGG + Intergenic
970229440 4:13893602-13893624 CTCTATCATAAGAACAGCATAGG - Intergenic
970785203 4:19788408-19788430 GTCTGTTGTAAACAGTGCATAGG + Intergenic
971477100 4:27082703-27082725 CTCTGTTTTAAGAACTGCAAAGG + Intergenic
971651211 4:29277441-29277463 CACTGTTATGAGAACAGCATGGG + Intergenic
971943356 4:33243048-33243070 CACTGTTATGAGAACAGCATGGG - Intergenic
974267311 4:59602209-59602231 CACTGTTATGAGAACAGCATGGG - Intergenic
974324246 4:60393397-60393419 CACTGTCACAAGCACAGCATGGG - Intergenic
974593599 4:63987676-63987698 CACTATTATAAGAACAGCATGGG - Intergenic
974703870 4:65486784-65486806 CACTGTTATAATCTCTGCAAAGG - Intronic
975429762 4:74275055-74275077 CTAGGTTTTAAGCCCTGCATAGG + Intronic
975724812 4:77281616-77281638 CTCTGCTATAGCCACTGCACAGG - Intronic
976143384 4:82016694-82016716 CTCTGTTATAATCTTTCCATGGG - Intronic
976269366 4:83215793-83215815 ATCTTTGATAAGCATTGCATTGG - Intergenic
977249076 4:94668999-94669021 CTCTGGTTTGAGCACTGAATGGG - Intergenic
977698973 4:99999787-99999809 CTTTGATATAAGCTCTACATTGG - Intergenic
978083536 4:104622457-104622479 CACTGTCATAAGAACAGCATGGG + Intergenic
978666143 4:111183996-111184018 GTCTATTATGAGAACTGCATGGG + Intergenic
979673257 4:123383600-123383622 GTGTGTTATGAGCACTGAATAGG + Intergenic
980103836 4:128567873-128567895 CTCTGTATTAAATACTGCATTGG + Intergenic
982432535 4:155338877-155338899 CACTGTTATAATAACAGCATGGG - Intergenic
982486133 4:155968047-155968069 CACTGTTACAAGAACAGCATGGG - Intergenic
983425287 4:167575776-167575798 CTCTAATATAAGCATAGCATGGG + Intergenic
983856803 4:172656946-172656968 CTCTGTTATGAGCACAGGGTAGG + Intronic
986228024 5:5835372-5835394 CTCTGTTATAACTGCTGCATGGG + Intergenic
986907488 5:12512825-12512847 CACTGTTATGAGAACAGCATGGG + Intergenic
987008840 5:13739297-13739319 CACTGTTATGAGAACAGCATGGG - Intronic
987675172 5:21064351-21064373 CACTGTTATGAGAACAGCATGGG - Intergenic
988159526 5:27502190-27502212 CACTGTTATGAGAACAGCATGGG + Intergenic
988394634 5:30680649-30680671 CACTGTCACAAGAACTGCATGGG - Intergenic
988728425 5:33946525-33946547 CTCTGTTATAAGCACTGCATAGG + Intronic
993481474 5:88430164-88430186 CACTGTCATGAGAACTGCATGGG + Intergenic
993578243 5:89628066-89628088 CACTGTCATAAGAACAGCATGGG - Intergenic
993845621 5:92939600-92939622 GTCTGCGATAAGCACTGCAGAGG + Intergenic
995792286 5:115902594-115902616 CTTTGTTTTGAGTACTGCATTGG + Intronic
995998923 5:118334090-118334112 CACTATTATAAGAACAGCATGGG + Intergenic
997037614 5:130212041-130212063 CACTGTCATAAGAACAGCATCGG + Intergenic
997401540 5:133607399-133607421 CACTGTTCTAAGCACTTCACAGG + Intronic
1000029334 5:157388796-157388818 CCCTGTTCTAAGCACTTGATAGG - Intronic
1000172315 5:158714135-158714157 ATCTGGTAGAAGCACTGTATGGG - Exonic
1003041629 6:2693443-2693465 ATCTGTTCTAAGCACTGTAAAGG - Intronic
1003800815 6:9664897-9664919 CACTGTTACAAGAACAGCATGGG - Intronic
1004549263 6:16630517-16630539 CTCTGATATCATCAATGCATTGG - Intronic
1004899206 6:20178764-20178786 CTCTGTGACAAGCACACCATGGG + Intronic
1005853176 6:29838214-29838236 CCCTGTGATAAGGAGTGCATAGG - Intergenic
1006689662 6:35871235-35871257 TTCTATTTTAAGCAGTGCATGGG - Intronic
1007148249 6:39659588-39659610 CACTGTCATAAGAACAGCATGGG - Intronic
1008307635 6:49923909-49923931 ATCTGTTATAACCTATGCATGGG + Intergenic
1010046969 6:71456468-71456490 CACTATTATAAGCCCAGCATGGG + Intergenic
1010145780 6:72668312-72668334 CTCTGTGTTAAGCATTGCAGAGG + Intronic
1010543804 6:77124900-77124922 GTCTGATAAAAGAACTGCATAGG + Intergenic
1010941688 6:81926536-81926558 GTCTGTTATGAGCCCTGTATTGG + Intergenic
1012306871 6:97669340-97669362 CTCTATTATCAGCAGTGCACTGG - Intergenic
1012474604 6:99605594-99605616 CTCTCTTGGAAGAACTGCATCGG + Intergenic
1012612933 6:101237647-101237669 CTCTGTTATGAGGACTGCACAGG - Intergenic
1014333469 6:120100890-120100912 TTTTATTATAAGCACTGCTTTGG - Intergenic
1014853109 6:126365519-126365541 CTCTGTTATGAGAACAGCAAGGG + Intergenic
1014873462 6:126626252-126626274 CTGTGTTCTAGGCACTGGATTGG + Intergenic
1015173368 6:130279306-130279328 CACTGTCATGAGAACTGCATGGG - Intronic
1016757434 6:147702199-147702221 CACTGTCATAAGAACAGCATGGG + Intronic
1017191757 6:151661744-151661766 CTCTGTCATGAGAACAGCATGGG - Intronic
1020372265 7:7444932-7444954 CTCTATTATAAGAACAGCAAGGG - Intronic
1023060782 7:36323737-36323759 CACTGTCATAAGAACAGCATAGG - Intergenic
1024850319 7:53706817-53706839 CTTAGTGATAAACACTGCATAGG - Intergenic
1028083914 7:86613883-86613905 CACTCTTATAAGTACAGCATGGG - Intergenic
1030901332 7:115128221-115128243 CTCTGTTCTAAGCATTCCAGAGG - Intergenic
1031741449 7:125436910-125436932 ATCTGAAATAAGCACTTCATGGG + Intergenic
1033885169 7:145934972-145934994 CACTGTTATGAGAACAGCATGGG - Intergenic
1033955761 7:146845836-146845858 ATTTGTTACAAGCACTGCAATGG - Intronic
1034098665 7:148432801-148432823 CACTGTTCTAAGCACTTTATAGG - Intergenic
1037216385 8:16457105-16457127 CACTGTTACAAGAACAGCATAGG + Intronic
1037368656 8:18149630-18149652 ATCTGTTATTAGCTATGCATAGG - Intergenic
1037753066 8:21695257-21695279 CTCTGTTATCATCACTGTAATGG + Intronic
1041013661 8:53569760-53569782 CACTGTCACAAGAACTGCATGGG - Intergenic
1041066858 8:54090831-54090853 CACTGTCATAAGAACAGCATGGG - Intronic
1042580032 8:70266537-70266559 CTCTATTCAAAGCCCTGCATGGG + Intronic
1043220808 8:77661442-77661464 CACTGTTATAAGCTTTGCAAAGG - Intergenic
1046814901 8:118572551-118572573 CTCTGTCATGAGAACAGCATGGG - Intronic
1048029007 8:130613332-130613354 CACTGTCATGAGAACTGCATGGG - Intergenic
1049959274 9:722824-722846 CACTGTTCTAAGCACTGGACAGG + Intronic
1051048388 9:12902134-12902156 CACTGTTATAAGAACAGCATGGG - Intergenic
1051739662 9:20239275-20239297 CTGTGTGTTAAGCATTGCATGGG + Intergenic
1052209932 9:25892119-25892141 CTGTCTGATAAGCACTGCTTTGG - Intergenic
1055732418 9:79292046-79292068 CTCTGTTACCAGCACTCCATGGG - Intergenic
1056507848 9:87274388-87274410 TTCTATTATCAGCACTGCTTTGG + Intergenic
1057914656 9:99046668-99046690 CACTGTTATGAGAACAGCATGGG + Intronic
1058279801 9:103099771-103099793 CTCTATCATAAGAACAGCATGGG + Intergenic
1059495558 9:114706238-114706260 CTTGGTTATAAGCTCTGCTTGGG + Intergenic
1059826778 9:118038819-118038841 CACTGTCATAAGAACAGCATGGG - Intergenic
1061324677 9:129856403-129856425 ACCTGTTATCAGCACTGCACAGG + Intronic
1185931919 X:4212980-4213002 CACTGTCATGAGCACAGCATGGG - Intergenic
1187496102 X:19797167-19797189 CTGTGATATAAGGACTGCAAAGG + Intronic
1188658278 X:32726650-32726672 AGCAGTTATAAGGACTGCATGGG + Intronic
1192016147 X:67333775-67333797 CGCTGTTGTAAGCAATGCATTGG - Intergenic
1193030526 X:76893268-76893290 CTCTATTATGAGAACAGCATGGG + Intergenic
1194598796 X:95894004-95894026 CTATGTTATTAACATTGCATAGG + Intergenic
1194672211 X:96748027-96748049 CTCTTTTATAAGCTCGTCATAGG - Intronic
1196681728 X:118476319-118476341 CTGTGTTTTAAACACTGAATGGG + Intergenic
1197074932 X:122342723-122342745 CTCTGTTATAAAAAAAGCATGGG + Intergenic
1198538605 X:137612137-137612159 CACTATTATAAGAACAGCATGGG - Intergenic
1198631424 X:138643131-138643153 CTCTGTTTTCAGCAGTCCATTGG - Intronic
1200857293 Y:7952708-7952730 TGCTGTTATATCCACTGCATTGG - Intergenic