ID: 988731950

View in Genome Browser
Species Human (GRCh38)
Location 5:33981187-33981209
Sequence CTCTGTGTAAGGAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 382}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988731950_988731956 4 Left 988731950 5:33981187-33981209 CCCTCTGCCTTCCTTACACAGAG 0: 1
1: 0
2: 1
3: 29
4: 382
Right 988731956 5:33981214-33981236 ATCTACCAACTGTGCTCCAACGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988731950 Original CRISPR CTCTGTGTAAGGAAGGCAGA GGG (reversed) Intronic
901318378 1:8324097-8324119 CTCTGAGTAGGGAAGGCACTGGG + Intronic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902552943 1:17230064-17230086 CTCTGTAAAAGGTAGGGAGAGGG - Exonic
904870975 1:33617973-33617995 CTTAGGGTAAGGAAGACAGAGGG - Intronic
904937596 1:34142489-34142511 CTCTGTTCAAGGCAGGCAGAAGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907074266 1:51564476-51564498 CTCTGTCTTAGGAAATCAGAGGG - Intergenic
907175374 1:52516498-52516520 TTCTGTGGAAGGAAAGAAGAAGG - Intronic
907267080 1:53269011-53269033 CTCTGAGTAGGGAAGGGACATGG - Intronic
907461513 1:54608283-54608305 CTCTGGGTGCTGAAGGCAGAAGG + Intronic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
909800803 1:79805534-79805556 TACTGTGAAAGAAAGGCAGAGGG - Intergenic
910500443 1:87883955-87883977 CTCTGTGTAAAGGGGTCAGAGGG + Intergenic
913333495 1:117686501-117686523 CACTGTCTAAGGCAGGCAGCTGG + Intergenic
913670761 1:121095502-121095524 CTCTGTTTAACTGAGGCAGAGGG + Intronic
916622106 1:166510524-166510546 CGCTGTGATAGGCAGGCAGAGGG - Intergenic
916962051 1:169898372-169898394 CTATGCATAAGAAAGGCAGAAGG - Intergenic
917015622 1:170528456-170528478 TCCTGAGTAAGGAAGGCATAAGG + Intergenic
917241044 1:172949136-172949158 CTCTGTGGAGGGAAAGCCGAGGG - Intergenic
917368662 1:174263075-174263097 GTCTGTGTCAGGAAGGCTGTAGG - Intronic
917488137 1:175473969-175473991 TTCTGTGGAAGCAAGGCAGAGGG + Intronic
918234781 1:182570188-182570210 CTCTGTGAACAGAAAGCAGAGGG - Intergenic
918534534 1:185559718-185559740 CTCTGAGTGAGGTAGGCAGGGGG - Intergenic
919035767 1:192307492-192307514 CTCTTTGCAAGGTAGGCAGAAGG - Intergenic
920256742 1:204660532-204660554 GTCTGTGTAAGGCGGGGAGAAGG - Intronic
921360124 1:214323835-214323857 CTCTCTGTTAGGGAGGCAGAGGG - Intronic
922935668 1:229420304-229420326 CTCAGTGCAAGGCAGGCAGGTGG - Intergenic
923410842 1:233707636-233707658 CCCTGTGTCAGCAAGGCTGATGG + Intergenic
1063149558 10:3323916-3323938 CTATTTGTAAGGAATGTAGAGGG - Intergenic
1063582939 10:7325458-7325480 CTCTGTGTAAGGAAGACCCATGG + Intronic
1065638935 10:27760952-27760974 TTCTGTTTATGGAAAGCAGAGGG - Intergenic
1066448072 10:35502139-35502161 CTCTGCTCAAGGAAGGAAGAGGG - Intronic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1068411427 10:56660630-56660652 CTCTGCTTGAGGAAGGAAGATGG - Intergenic
1069613197 10:69789163-69789185 CTCTGTGTGGGGAAGGCTGTGGG + Intergenic
1070059386 10:72967617-72967639 TTCTGTTTGAGGAAAGCAGAGGG - Intergenic
1070436772 10:76401547-76401569 ATCTATGTCAGGGAGGCAGAAGG - Intronic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1071767870 10:88689388-88689410 CTCTGTTTATGGAAGGGTGAAGG + Intergenic
1071915022 10:90284929-90284951 CTTTCTGTCAGGAAGGCTGAAGG - Intergenic
1073890028 10:108090764-108090786 CTCTGCTTAAGGAAAGGAGAAGG + Intergenic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1075739511 10:124685768-124685790 CCATGGGAAAGGAAGGCAGATGG - Intronic
1076593556 10:131609149-131609171 CTCTCTGGAAGCAAGGAAGAGGG + Intergenic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077761358 11:5103136-5103158 CTTTCTGGAAGGAAGGAAGAAGG + Intergenic
1079069246 11:17328847-17328869 CCCTGTTTGAGGAAAGCAGAGGG - Intronic
1079364383 11:19796653-19796675 CTCTGTGGAGGGAAGGCTGGTGG + Intronic
1079408776 11:20167202-20167224 GTCAGTGTAGGGAAGGGAGAGGG + Intergenic
1079525955 11:21388109-21388131 CTCTGTAGAAGGAAGGCTGAAGG - Intronic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080687446 11:34526972-34526994 CTCTGTGTAAATTAGACAGAGGG - Intergenic
1080883110 11:36341054-36341076 CTCCGGGAAAGGCAGGCAGATGG + Intronic
1081036273 11:38149949-38149971 CTCTTAGAAAGGAAGGCACAAGG - Intergenic
1081367435 11:42253128-42253150 CACTGTTTAAAGAAGGAAGAAGG + Intergenic
1081673791 11:44956677-44956699 CTCTGGGAAAGGAAGTCACAGGG + Intergenic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1082702427 11:56449352-56449374 CTCAGCAGAAGGAAGGCAGAAGG + Intergenic
1082703976 11:56469795-56469817 CTCAGCAGAAGGAAGGCAGAAGG - Exonic
1083591678 11:63899033-63899055 CTATCTGAAAGGAAGGAAGAAGG - Exonic
1084024286 11:66438256-66438278 CTCTCTGTGAGGGAAGCAGAGGG + Exonic
1084032593 11:66489661-66489683 CTCTGGGTCAGGAATGCAGGTGG + Intronic
1084594405 11:70108471-70108493 CTCTGTGGGAGGCAGGCAGCCGG + Intronic
1084780809 11:71407158-71407180 CTCCGTGATAGGAAGGCAGTAGG - Intergenic
1085278345 11:75314217-75314239 TTGTGTGTAAGGAAGGGATAGGG + Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1088628369 11:111749819-111749841 CAGTGTGAAAGCAAGGCAGATGG - Intronic
1089460806 11:118652291-118652313 CTCTGGGCCAGGAAGGTAGAGGG + Intronic
1089836424 11:121374448-121374470 CTTTGTGTCAGGTAGGCAGAGGG + Intergenic
1090503506 11:127285009-127285031 TTCTGTGTAATGTAGGTAGAAGG + Intergenic
1090852786 11:130585185-130585207 CTCTGTGACAGGAAGCCCGAGGG + Intergenic
1090943476 11:131409394-131409416 CTCTGTGGAAGGCAGCCAGAAGG - Intronic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1093864056 12:24203592-24203614 CTCTGTCAAAGAAAGGAAGAGGG - Intergenic
1095267142 12:40173900-40173922 CACTGAGTAAGGAAGACACAGGG + Intergenic
1095949903 12:47776223-47776245 CTAAGGGTAAGGAAGGCATAGGG - Intronic
1096371228 12:51070820-51070842 CTCTCTATAAGGGAGGCAGTTGG - Intronic
1096805903 12:54141014-54141036 CTCTGTGGAGGGAAAGCTGAGGG - Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098219371 12:68252448-68252470 CTCTGTGGAAGGAGGGAAGGAGG + Intronic
1098629709 12:72710233-72710255 TTATGTGTAGGGAAGGCAGGGGG + Intergenic
1099200583 12:79672164-79672186 CTCTGTGTACGGGAAGGAGAGGG - Intronic
1100289788 12:93202775-93202797 ATCTGTGGAAGGAAGGAAGAAGG + Intergenic
1101252037 12:102946158-102946180 CTCTGTTTGAGGAAAGGAGAGGG - Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1103180933 12:118910740-118910762 CTATGTGGATGGAAGCCAGATGG + Intergenic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103426063 12:120835212-120835234 CACTCAGAAAGGAAGGCAGAAGG + Intronic
1104076967 12:125398499-125398521 CTCAGTGTCAGGGAGGCAGTAGG + Intronic
1104488404 12:129172474-129172496 AGCTGAGTGAGGAAGGCAGATGG - Intronic
1104662267 12:130619941-130619963 CTCTGTGCCAGGAAGACAGAGGG + Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104810349 12:131616803-131616825 TTCTCTGGAGGGAAGGCAGAAGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105946574 13:25195653-25195675 CTCAGAGTGATGAAGGCAGATGG - Intergenic
1106584150 13:31042912-31042934 CTCCCTGAAAGGATGGCAGATGG - Intergenic
1106914149 13:34494293-34494315 CACTTTGTAAGGCAGGTAGATGG + Intergenic
1107192742 13:37609148-37609170 CTCTTTGTAAGAAATGCAAAAGG - Intergenic
1108437994 13:50420284-50420306 CTCTTTGTAAGACAGGCAGTAGG - Intronic
1111486442 13:88907020-88907042 CTCTGTGTTAGGAAAGAACATGG + Intergenic
1112302275 13:98240983-98241005 CTCAGGAGAAGGAAGGCAGAAGG + Intronic
1112582525 13:100688727-100688749 CTCTGAGTAGGGAATGCAGTAGG - Intergenic
1112645401 13:101325820-101325842 CTCTGTGAAATGAGGCCAGAAGG - Intronic
1112686323 13:101832103-101832125 CTCCTCGTAAGAAAGGCAGAGGG + Intronic
1113882309 13:113634136-113634158 CTCTGTGTCCGGCTGGCAGACGG + Intronic
1114360248 14:21964023-21964045 GTATGTGTGAGAAAGGCAGAGGG - Intergenic
1114866798 14:26605519-26605541 CTCAGTGTCAGGAAGATAGAGGG + Intergenic
1115326215 14:32142594-32142616 CTCTCTGAAGGGAAGGCACAAGG - Intronic
1115376372 14:32681412-32681434 CTCTGGGTCAAGAATGCAGAAGG + Intronic
1116126357 14:40792258-40792280 CTATGTTTAAGAAAGCCAGAGGG - Intergenic
1116688666 14:48076593-48076615 CTGTGTGTAAAGCAGGCAGCTGG - Intergenic
1117053570 14:51887163-51887185 CTCTGAATAAGGAAAGCATAGGG - Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118235916 14:64004901-64004923 TTCTATGTAAGGAAGGAGGAGGG + Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119903346 14:78280771-78280793 CCCTTTGAAAGGATGGCAGAAGG - Intronic
1121234187 14:92380234-92380256 CTCTGTTTAATGAGGACAGAGGG - Intronic
1121357980 14:93231183-93231205 CTCTGTGTCAGGAAGGGCGGCGG - Intergenic
1122221009 14:100239146-100239168 CCGTGGGGAAGGAAGGCAGAGGG - Exonic
1122526675 14:102390977-102390999 ATCTGAGTCAGGAAGGTAGAGGG + Intronic
1122802723 14:104239630-104239652 CTATGAGAAAGGACGGCAGAAGG + Intergenic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1123433965 15:20241439-20241461 CTTTGTGTGACCAAGGCAGAAGG + Intergenic
1123878541 15:24651161-24651183 CTCTCAGTAATGATGGCAGATGG + Intergenic
1123894269 15:24812861-24812883 CTCTGTGTCATGAAGACTGATGG + Intergenic
1124378174 15:29141716-29141738 CCAAGTCTAAGGAAGGCAGAGGG - Intronic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1124733166 15:32217263-32217285 CTCTCTCTAAGGAAGTCAAATGG + Intergenic
1124889787 15:33722177-33722199 TTCCTTGAAAGGAAGGCAGATGG - Intronic
1125766770 15:42141575-42141597 CTCAGTGTAAGGAGGACAGCTGG + Exonic
1127051496 15:55088733-55088755 ATCAGTGTAAGTAAAGCAGAGGG - Intergenic
1128249909 15:66156673-66156695 CCCTGGTTAACGAAGGCAGAAGG - Intronic
1128639279 15:69324209-69324231 CCCTGTGTGAGGATGGCAGGGGG - Intronic
1128731792 15:70026310-70026332 TGCTGTGTAGGGAAAGCAGAAGG + Intergenic
1128969001 15:72089534-72089556 CTCTGGGAAAGGAAGGGAGGAGG + Intronic
1129088207 15:73119710-73119732 TTCTGAGTAGGGAAAGCAGATGG - Intronic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1129581478 15:76816055-76816077 CTCTGGGTAAGGGAGGGTGAGGG + Intronic
1130668618 15:85890774-85890796 CTCTCTCCAAGGAAGGCAGATGG - Intergenic
1130919227 15:88330182-88330204 CTCTGTCCAAGGAAGGCATATGG + Intergenic
1132323439 15:100944631-100944653 TTTTGTGTTTGGAAGGCAGATGG + Intronic
1133665704 16:7965816-7965838 CTCTGTATGAGAAAGGGAGAAGG + Intergenic
1134878781 16:17726105-17726127 TTCTGCATAAGGAAGGCAGGGGG - Intergenic
1135980033 16:27140263-27140285 CTCAGTCTAAGGAAGGCGGTGGG + Intergenic
1136850653 16:33609671-33609693 CTTTGTGTGACCAAGGCAGAAGG - Intergenic
1137483902 16:48875952-48875974 CCCTGTGTGAGTCAGGCAGAGGG - Intergenic
1137896292 16:52216404-52216426 TGATGTGTAAGGAAGGCAGGGGG + Intergenic
1138111565 16:54328297-54328319 CTCTGTATAATGAAGCTAGAGGG - Intergenic
1138863245 16:60785399-60785421 TTGTGTGTAAAAAAGGCAGAGGG - Intergenic
1139585623 16:67901257-67901279 CTATGTCTCAGGAAGACAGAAGG + Intronic
1140238214 16:73178010-73178032 CTCAGAGTAAGGAAGCTAGAAGG - Intergenic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142024451 16:87804971-87804993 CTCTGGGGAAGGAAGGATGACGG - Intergenic
1142269359 16:89081128-89081150 CTCACTGTAAAGAAGACAGATGG - Intergenic
1203112266 16_KI270728v1_random:1458125-1458147 CTTTGTGTGACCAAGGCAGAAGG - Intergenic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1144079119 17:11746345-11746367 CACTGTGCAAGGAAGACAAAGGG - Intronic
1144648026 17:16988535-16988557 CTCTGTGTGAGGAAGCCCCATGG + Intergenic
1145282057 17:21475386-21475408 CTCTGGGTAGGCTAGGCAGAGGG - Intergenic
1145942269 17:28748821-28748843 CTCTACGTGAGGAAGACAGAGGG - Intronic
1146151045 17:30472548-30472570 CTCTGTGGAGCGAAGCCAGATGG + Intergenic
1146337917 17:31991122-31991144 GCCTGTTTAAAGAAGGCAGAAGG + Intronic
1146526768 17:33573425-33573447 CTCTGAGGAGGGAAGGTAGATGG - Intronic
1146790014 17:35745816-35745838 CTCTGTGGAAGTGAGGCAGGAGG - Exonic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1147562735 17:41518974-41518996 GTGTTTGTCAGGAAGGCAGAAGG - Exonic
1150171126 17:62996025-62996047 CTCTGTGAAAGGCATGCTGAAGG - Intergenic
1151345430 17:73498486-73498508 CTCTGTGCCGGGCAGGCAGAAGG + Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152686483 17:81696208-81696230 CTCTGGGGGAGGCAGGCAGAGGG - Intronic
1153307887 18:3649533-3649555 CACAGTGTACGGAAGGCAGTAGG - Intronic
1153724827 18:7943773-7943795 CTATTTATGAGGAAGGCAGAAGG - Intronic
1155185075 18:23380381-23380403 CTCCTTGTCAGGCAGGCAGAGGG - Intronic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1158024993 18:52885704-52885726 TTCTGTTTGAGGAAAGCAGAGGG - Intronic
1158116913 18:54005749-54005771 TTATGTGTAAGGAAAGGAGAGGG + Intergenic
1158959177 18:62574467-62574489 CTGTGTGGAAGGAAGGTTGATGG - Exonic
1159299693 18:66547294-66547316 CTTTATGCAAGGAAGGAAGAGGG + Intronic
1160550229 18:79690149-79690171 ATCTGTAGAAGGAAGGGAGAAGG + Intronic
1161039455 19:2102267-2102289 CCCTGTGTAAGGAAAAAAGATGG + Exonic
1161323716 19:3653046-3653068 CTCTTTGGGAGGCAGGCAGATGG - Intronic
1163114376 19:15180305-15180327 ATCTGTGTGATGGAGGCAGAAGG - Intronic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1163895263 19:20052746-20052768 CTCTGGCTAGAGAAGGCAGAGGG - Intergenic
1163897889 19:20075601-20075623 CTCTTCGAAAGGAAGGAAGAAGG - Intergenic
1164896465 19:31881607-31881629 CACGGTGGAAAGAAGGCAGAGGG + Intergenic
1165030181 19:32992563-32992585 CTTTGTGTGACCAAGGCAGAAGG + Intronic
1165608203 19:37125440-37125462 CTATGTGTAAGGAAGTTATAGGG + Intronic
1166756510 19:45195598-45195620 CTCTGAGGAAGGAAGGAAGGAGG - Intronic
1166887118 19:45968491-45968513 CTAAGTGAAAGAAAGGCAGATGG + Intronic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
924965886 2:76182-76204 ATCTTTCTAAAGAAGGCAGAGGG + Intergenic
924993407 2:336032-336054 CTTTATGAAAGGGAGGCAGAGGG + Intergenic
925949868 2:8900044-8900066 AGCTGTTCAAGGAAGGCAGAAGG + Intronic
926686148 2:15699252-15699274 TTCTGTGTAAGGGAGACTGATGG - Intronic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
926911046 2:17852622-17852644 CTCAGTGGAAGGCAGGGAGAAGG + Intergenic
926945525 2:18183612-18183634 CTGTGTGCAAGGAAGACAAAGGG + Intronic
927072605 2:19546371-19546393 CTCTGTGCAAGGAGGACACAAGG - Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928945123 2:36765197-36765219 CTTTGTAAAAGGAAGGCAGAGGG + Intronic
929744636 2:44643259-44643281 CACTGTGTAAGGCATGGAGAGGG + Intronic
929790869 2:45022014-45022036 CTCTGTGTTAGGCTGTCAGAGGG + Intergenic
930157131 2:48117203-48117225 CTCTGAGTTGGGAATGCAGACGG - Intergenic
930872168 2:56181450-56181472 CTACGTGTAAGGCAGGAAGAAGG - Intergenic
931460602 2:62447262-62447284 CTCTGCATCAGGATGGCAGAAGG + Intergenic
931748456 2:65310626-65310648 CTCAGTGAAAGGAAGGCTGCAGG - Intergenic
934676236 2:96251743-96251765 ATCAGTGTCAGGATGGCAGAGGG + Exonic
935547263 2:104413988-104414010 CTCTGTGGAAGGCAAGCATACGG - Intergenic
935736219 2:106108586-106108608 TTCTGTGAAATGAAGCCAGAGGG - Intronic
937074343 2:119090083-119090105 CTCTCTGTAGGCTAGGCAGAGGG + Intergenic
937444606 2:121947104-121947126 CTCTGTGTTAGGAAAGACGAGGG + Intergenic
937879638 2:126855874-126855896 CTCTGTGTAGGGAAGGTGGGAGG - Intergenic
939239438 2:139538905-139538927 CCCAGTGTGAGGGAGGCAGAAGG - Intergenic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
939758690 2:146147284-146147306 CTATCTCTAAGGTAGGCAGAAGG - Intergenic
940288758 2:152057799-152057821 CTCTGCCTATGGCAGGCAGAGGG + Intronic
940910608 2:159206408-159206430 CTCTCTGCGAAGAAGGCAGAGGG + Intronic
940998272 2:160173962-160173984 CTGTGTGTAAGGTATGCTGAAGG - Exonic
943329715 2:186544235-186544257 CTCTGTTTTAGGAAGAAAGAAGG - Intergenic
943344057 2:186716367-186716389 TTCTGGGTAAGGAAGGAAAAGGG - Intronic
943753220 2:191531724-191531746 ACCTGTGGGAGGAAGGCAGATGG + Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946061084 2:216942075-216942097 CTCTGTGCCAGGAATGAAGATGG - Intergenic
946096249 2:217276874-217276896 CTCTTTGGAAGGAAGGCACTAGG + Intergenic
946160104 2:217830680-217830702 CTCTGAGGAAGGAAGGAGGATGG - Intronic
946276083 2:218632905-218632927 CTATGGGGAAGGGAGGCAGAGGG + Intronic
946953711 2:224905804-224905826 CCCTGTGTAAAGAATGGAGAAGG - Intronic
947239430 2:227978173-227978195 CACTGTGAAAGGAAGACAGTGGG + Intergenic
947793145 2:232879112-232879134 CCCTGTGGGAGGCAGGCAGAAGG - Exonic
1169628621 20:7600348-7600370 CTCTGCTTAAGAAAAGCAGAGGG + Intergenic
1173963931 20:47097442-47097464 CACTGTCTTAGGAAGGGAGACGG - Intronic
1173996672 20:47343872-47343894 CTCTTTGGAAGGAAGTCACAAGG - Intronic
1174285222 20:49468078-49468100 CTCTGTAAATGGAAGGCAAAAGG + Intronic
1175287898 20:57850017-57850039 GTCTGGGTTAGGAAGCCAGAAGG + Intergenic
1175716642 20:61259061-61259083 CTTTGTTTTAGGAAGGAAGAAGG + Intronic
1177867100 21:26525485-26525507 CTCTGGGGAAGGAAGGCGGCAGG - Intronic
1179501953 21:41815645-41815667 CACTGTGTAGGGAAGCCAGGTGG - Intronic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1181104517 22:20565919-20565941 CCCGGTGTCAGGAAGGCAGCTGG + Intronic
1182853772 22:33499349-33499371 CCCTGTCTAACTAAGGCAGATGG + Intronic
1183548446 22:38467839-38467861 TTCTGCGGAGGGAAGGCAGAGGG + Intergenic
1183694185 22:39411128-39411150 TTCTGTGTAAGGTAGGAAGGAGG - Intronic
1184030446 22:41891274-41891296 CTTTGTGGAAGGTTGGCAGAGGG + Intronic
1184162350 22:42704541-42704563 CTGTTTGTAAGAAGGGCAGAAGG + Intronic
1185355027 22:50363251-50363273 CTAAGTGTAAGGAAGGAAGCTGG - Intronic
955066999 3:55542377-55542399 CTCTGTGAAAAGAGTGCAGAAGG + Intronic
956034372 3:65074322-65074344 CTCTGTGAAACGAAGAAAGAAGG + Intergenic
956175764 3:66471628-66471650 CTCAGTTAAAGGATGGCAGAGGG + Intronic
956455619 3:69417975-69417997 CCCTGTGAAAGAAAGGCAAAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957090904 3:75729147-75729169 ATTTGTGTCAGGTAGGCAGAGGG + Intronic
957803870 3:85121146-85121168 CTCAGGGTAATAAAGGCAGAGGG + Intronic
958852479 3:99345721-99345743 CACAGTGTAAGGCAGGAAGAGGG - Intergenic
963495880 3:146060333-146060355 CCCTGTGTTAGCAATGCAGATGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964276702 3:155016209-155016231 CACTTTGTAAGGCAGGCTGAAGG + Intergenic
964804143 3:160588092-160588114 CTCTGCCTATGGAAAGCAGAGGG + Intergenic
968763726 4:2457436-2457458 CTCTGTGGCAGGAAGGAGGAGGG + Intronic
969300641 4:6294975-6294997 CTCTGTGTGAGGGTGGCAGTGGG + Intronic
969345739 4:6568701-6568723 CTCTGTGCATGTAAGGCAGGAGG - Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
971453729 4:26823890-26823912 TTCTGTATAAAGAAGGAAGAGGG - Intergenic
972113140 4:35591566-35591588 CTTTGTGAAAGAAAGGCTGATGG - Intergenic
972369991 4:38414176-38414198 CTCTGTTTTAGGCAGTCAGATGG - Intergenic
972732928 4:41813033-41813055 GGGTGTGGAAGGAAGGCAGAAGG - Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
974414967 4:61595213-61595235 TTCTGTTTAAGAAAAGCAGAGGG - Intronic
974436220 4:61860623-61860645 CTCTGGGGAAGGACCGCAGATGG - Intronic
976059872 4:81114739-81114761 CACTGTGGGAGGAAGACAGAAGG - Intronic
976974174 4:91146897-91146919 CTCTGGGAAAGGGAGACAGAGGG + Intronic
976982068 4:91243863-91243885 TTCTGTTTAAGAAAAGCAGAGGG + Intronic
977779556 4:100964734-100964756 AACTGTGTAAGGGAGGCCGAAGG + Intergenic
977945915 4:102913919-102913941 CTCTGTCTAAGCAGGGCACAAGG - Intronic
980820833 4:138014651-138014673 CTCTGTGTAATGAATTGAGAAGG - Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
981129952 4:141147546-141147568 CTCTATGTACACAAGGCAGAGGG + Intronic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
982352557 4:154431778-154431800 CTGTATGTAAAGAAGGCTGAAGG - Intronic
983071527 4:163273543-163273565 CTATGTGTTAGGAATTCAGATGG + Intergenic
983265819 4:165507044-165507066 CTCTGTGTATTTAATGCAGAAGG - Intergenic
986471563 5:8081542-8081564 CTTGGGGCAAGGAAGGCAGAGGG + Intergenic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
990374094 5:55152010-55152032 CCCTGTAAGAGGAAGGCAGAGGG + Intronic
990630329 5:57661812-57661834 CTCTGAGTCAGGAAGGCAAAGGG + Intergenic
991312651 5:65261628-65261650 CTCTAAGTAAGGAAGGGAAATGG + Intronic
991473625 5:66996751-66996773 CTCTATGAAAGTGAGGCAGAGGG - Intronic
992492008 5:77254541-77254563 CCCTTTGTGAGAAAGGCAGAAGG - Intronic
992575647 5:78108261-78108283 TTATGAGTAATGAAGGCAGATGG - Intronic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994674974 5:102809528-102809550 CTGTGTGGAAGGTAGGCAGATGG + Intronic
995265357 5:110152905-110152927 TTCTGTTTAAGAAAAGCAGAGGG + Intergenic
995865267 5:116683596-116683618 CTCTGGGAAAGCAAGGCAGGGGG + Intergenic
996411245 5:123161769-123161791 CTCTGTGTGAGCTAGGCAAAGGG + Intronic
996836695 5:127801481-127801503 CTCAGTGTAAGGCAGAGAGAGGG - Intergenic
997857376 5:137384177-137384199 CTCTGTATACAGGAGGCAGATGG + Intronic
997862516 5:137430871-137430893 CTCAGTGTAAAGAAGGCAAGTGG - Intronic
998432795 5:142080941-142080963 CTATGGGTCAGGAAAGCAGATGG + Intergenic
998929901 5:147170002-147170024 CTCTGTCTCAGGAAGGGACAAGG + Intergenic
998983991 5:147734896-147734918 CTCTGTGTAAAGTGGACAGATGG + Intronic
999247964 5:150165490-150165512 CTCTGGGTCAGGAAGTCAGATGG - Intergenic
999844094 5:155459361-155459383 ACCTGTGGAAGGAAGGAAGAAGG - Intergenic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1001379857 5:171297707-171297729 CTCTGTGAAATGATGGCAGGTGG + Intronic
1002809270 6:611096-611118 CTCTCTGTAAGGAAAGGAGATGG + Intronic
1002809279 6:611166-611188 CTCTCTGTAAGGAAAGGAGATGG + Intronic
1003197635 6:3929113-3929135 TTCTATGTAAGAAAGGAAGATGG + Intergenic
1003911919 6:10750863-10750885 TTCTGTCTAAGGAGGGAAGATGG + Intronic
1003946090 6:11077232-11077254 ATGAATGTAAGGAAGGCAGATGG - Intergenic
1004318400 6:14612411-14612433 CTCTGCTGAAGGAAGTCAGAGGG + Intergenic
1004527621 6:16424128-16424150 ATCTGTCTAAGGTAGACAGAGGG + Intronic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1006736612 6:36278037-36278059 CTCTCTGAAAGGGGGGCAGAGGG - Intronic
1007616941 6:43185805-43185827 ATTTGTGTAAGAAAGGCATAGGG - Intronic
1007630081 6:43268576-43268598 CTCTGTCTCAGGAAGAGAGAGGG + Intronic
1008208776 6:48694796-48694818 CTCTGCCTAAGGAAGCCTGATGG + Intergenic
1008644578 6:53500877-53500899 CCCAGGGTAACGAAGGCAGAAGG + Intronic
1008723408 6:54386538-54386560 CTCTGTGTGAGGGAGCCACATGG - Intronic
1009529278 6:64789345-64789367 CTCTGGTTAAGAAAGGCAGAAGG - Intronic
1011053192 6:83176907-83176929 CCCTGTGAAAGGCAGGCAAATGG + Intronic
1011105921 6:83781429-83781451 CTTGGTGTAAGGAAGTGAGATGG + Intergenic
1011339274 6:86294755-86294777 CTGTGTGTAGAGAAGTCAGAAGG - Intergenic
1011625408 6:89279267-89279289 GTCTGTGTGAGGCAGGCAGCGGG + Intronic
1012758349 6:103263126-103263148 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1012798964 6:103801400-103801422 CTCTGTTTAAGCAAGTCAAATGG + Intergenic
1012936824 6:105376858-105376880 ATCTCTGTAAGAATGGCAGAGGG + Intronic
1015477912 6:133673743-133673765 CTCTTTATAAGGAAGTCACAGGG + Intergenic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015847167 6:137532653-137532675 CTTTGTGGAGGGAAGGCAGAGGG - Intergenic
1016363461 6:143291740-143291762 CTGTGTTCAAGGAAAGCAGAAGG + Intronic
1016749959 6:147621501-147621523 CTCTGTGTCAGCAAGAGAGAAGG - Intronic
1017546621 6:155458483-155458505 CACTGTGTAAAGAACACAGAAGG - Intergenic
1018433943 6:163744535-163744557 CGGTGTGTAAGGAAGGAACATGG + Intergenic
1018483360 6:164214331-164214353 CTGTGTGTGTGGAAGGCAGTTGG + Intergenic
1018925968 6:168207290-168207312 ATCTTTCTAAGGAAGGGAGAGGG + Intergenic
1020607383 7:10356265-10356287 TTCTGTTTGAGGAAAGCAGAGGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1026344500 7:69462507-69462529 GGCTGTGTAAGCAAGGAAGAAGG + Intergenic
1026739947 7:72972838-72972860 CTCTCAGGAAGGTAGGCAGAAGG - Intergenic
1027103786 7:75392232-75392254 CTCTCAGGAAGGTAGGCAGAAGG + Intergenic
1028577627 7:92369887-92369909 CTCTGTCCATGGAAGGGAGAGGG + Intronic
1029570964 7:101369018-101369040 CTCTGTGTAAGAAAAGGAGGAGG - Intronic
1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG + Intronic
1030433742 7:109488052-109488074 CTCTGTGCATGGAAAGCACAGGG + Intergenic
1032080487 7:128856222-128856244 CTCTGTGTGAAGCAGGCTGAGGG - Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1034003438 7:147442553-147442575 TTCTGCTTAAGAAAGGCAGAGGG - Intronic
1034400020 7:150856192-150856214 CCCTGAGTAAGGAAGGCTGCAGG + Intronic
1035047706 7:155980171-155980193 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1037581263 8:20247209-20247231 CTCTGTGTATGGAAGGTACCGGG + Exonic
1037870096 8:22486216-22486238 TTGTTTGTAAGGAAGACAGAGGG - Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1039348997 8:36740572-36740594 TTATATGTAATGAAGGCAGAAGG - Intergenic
1039574530 8:38612727-38612749 TTCAGTGAAAAGAAGGCAGAAGG + Intergenic
1041179075 8:55229163-55229185 CTGTTTGTAAGGCAGGCAGCAGG + Intronic
1042257934 8:66825674-66825696 CTCTGTGTAAATAAGGGAGTAGG - Intronic
1042303220 8:67308207-67308229 CTGTGTGTCAGGAATTCAGATGG - Intronic
1042612334 8:70613037-70613059 CCCTGTGAAAGGAAGGAAGAAGG + Intronic
1042654866 8:71084988-71085010 CTCTGTCTAAGAAAGGAAGGAGG - Intergenic
1042867760 8:73370510-73370532 CTCTCTCTGAGGAAGACAGATGG + Intergenic
1042989808 8:74626441-74626463 CTCTGTGGATGGAAGTAAGAGGG + Intronic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1044915546 8:97109494-97109516 TTCTGGGTCAGGAAGGAAGATGG - Intronic
1046059041 8:109114455-109114477 CTTTCTGTAGGGAAGACAGAAGG + Intronic
1046834373 8:118783043-118783065 CTCTGGGTAAGTAAGCCACATGG - Intergenic
1047803820 8:128337954-128337976 CTCTGTGGAAGTAACGCTGATGG + Intergenic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1048408676 8:134149499-134149521 CTCTGTGAAGGAAAGGTAGATGG + Intergenic
1048542140 8:135352232-135352254 CTCTGTGTGAGTCAGGAAGAAGG - Intergenic
1049640028 8:143711311-143711333 CATTGTGTTAGGAAGGCAGGCGG + Intronic
1050772479 9:9219728-9219750 TTCTGTGGAGTGAAGGCAGAAGG + Intronic
1051226377 9:14903665-14903687 CTATGTGTTTTGAAGGCAGAAGG + Intronic
1051268589 9:15332773-15332795 CTCTGTCTAAGGAAGGGACCTGG - Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052044609 9:23779474-23779496 CTGAGTCTAAGGAAGCCAGAAGG - Intronic
1052235646 9:26210930-26210952 CTCTCTGTAAGGAGGGAAGGGGG - Intergenic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1054867895 9:70021382-70021404 CTCTGAGTAATGAATGCATAGGG - Intergenic
1054998017 9:71414403-71414425 CTTTGTGAAAGGAAGGAAAAAGG - Intronic
1056519751 9:87389296-87389318 CTTTGTGCAAAGCAGGCAGAGGG - Intergenic
1056748977 9:89331630-89331652 CCCTGTGTTATGAAGACAGAAGG - Intronic
1058547473 9:106076247-106076269 CTCTGTGTAAGGAAAGCCACAGG - Intergenic
1059039735 9:110799775-110799797 CTCTGTGAAAGGATGACAGTAGG + Intronic
1060061570 9:120465186-120465208 CTCTGTGTAAAGAAAGCATGTGG - Intronic
1060112507 9:120916755-120916777 TTCTATGGAAGGCAGGCAGAGGG + Intronic
1060251495 9:121989811-121989833 CTCTGTGTTAGGGATCCAGAGGG - Intronic
1061242958 9:129384844-129384866 CTCTGTGAAACTGAGGCAGAAGG + Intergenic
1061652000 9:132058219-132058241 CTCTCTGTGAGGTAGGAAGAGGG - Intronic
1061970230 9:134040978-134041000 GTCTGTGCAAGGAAGACAGAGGG + Intronic
1062169267 9:135125686-135125708 CTCTGTGTCCAGAAGGCAAAAGG + Intergenic
1186060394 X:5699138-5699160 CTCTGTGTCAGGAAAGCCAATGG + Intergenic
1188851944 X:35142936-35142958 CTCTGTGCCAGGAAAGCAGCAGG - Intergenic
1189066555 X:37815942-37815964 CACTGGGTAAGGAATGCAGCAGG - Intronic
1192560908 X:72127370-72127392 ATCTGGGAAAGGAAGGAAGAGGG + Intronic
1194301130 X:92187318-92187340 GTCTTTGTAAGGAAAGAAGAAGG - Intronic
1195064674 X:101230198-101230220 CACTCTATAAGGAAGGCAGGGGG + Intronic
1196119732 X:112036879-112036901 TTCTGTGTAGGGAAGACATATGG - Intronic
1197068679 X:122266928-122266950 TCCTGTGTGAGGAAAGCAGAGGG - Intergenic
1197693999 X:129531396-129531418 ACCAGTGGAAGGAAGGCAGAGGG - Intergenic
1197787962 X:130219184-130219206 CTTTATGTAAAGAAGTCAGAGGG + Intronic
1198546981 X:137702685-137702707 CTCTGGGGAAGGAAAGCAAAGGG - Intergenic
1198734990 X:139775696-139775718 CCCTAGGTAAGGAGGGCAGAGGG - Intronic
1198794210 X:140378476-140378498 CTCTGTGGTGGGAAGGCAGGGGG + Intergenic
1199752387 X:150832682-150832704 CTCTCTGTAGGAAAGGAAGAAGG + Intronic
1202257275 Y:22934767-22934789 GTCTTTGTAAAGAAGGAAGAAGG + Intergenic
1202410266 Y:24568514-24568536 GTCTTTGTAAAGAAGGAAGAAGG + Intergenic
1202460516 Y:25101558-25101580 GTCTTTGTAAAGAAGGAAGAAGG - Intergenic