ID: 988739805

View in Genome Browser
Species Human (GRCh38)
Location 5:34059174-34059196
Sequence CACCCTGTACACCTTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988739805_988739810 28 Left 988739805 5:34059174-34059196 CCAAGATCAAGGTGTACAGGGTG 0: 1
1: 0
2: 0
3: 18
4: 140
Right 988739810 5:34059225-34059247 CATCTTGCTGAGTCCCTACATGG 0: 1
1: 0
2: 9
3: 101
4: 873
988739805_988739807 1 Left 988739805 5:34059174-34059196 CCAAGATCAAGGTGTACAGGGTG 0: 1
1: 0
2: 0
3: 18
4: 140
Right 988739807 5:34059198-34059220 GTGTCTCCTTGGTTTGCAAATGG 0: 1
1: 2
2: 7
3: 95
4: 741
988739805_988739806 -10 Left 988739805 5:34059174-34059196 CCAAGATCAAGGTGTACAGGGTG 0: 1
1: 0
2: 0
3: 18
4: 140
Right 988739806 5:34059187-34059209 GTACAGGGTGTGTGTCTCCTTGG 0: 1
1: 0
2: 1
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988739805 Original CRISPR CACCCTGTACACCTTGATCT TGG (reversed) Intronic
900711341 1:4116529-4116551 GATCCTGGACACCTTGATCCTGG - Intergenic
902673993 1:17995696-17995718 CGCCTTGGACACTTTGATCTTGG - Intergenic
903057241 1:20644738-20644760 CTCCATGTGCACCTTGATCAGGG + Intronic
904937014 1:34138220-34138242 AACCCTTAAAACCTTGATCTGGG - Intronic
906279653 1:44544339-44544361 CACCCTGTTCCTCTTGTTCTTGG + Intronic
907262034 1:53226046-53226068 CACACTATACAACTTGGTCTTGG + Intergenic
907950607 1:59179632-59179654 CCCCATGGACACCTTGACCTTGG - Intergenic
917521921 1:175754833-175754855 CACCCTTTACAGCGTGTTCTGGG + Intergenic
920310655 1:205046439-205046461 CACCCTGAACACCCTGACCAAGG + Intronic
1062957691 10:1551230-1551252 GCCCCTGGACACCTTGATCTCGG + Intronic
1065687217 10:28298327-28298349 CACTCTGTACCCATGGATCTAGG - Intronic
1066404546 10:35106247-35106269 CACCAGACACACCTTGATCTTGG + Intergenic
1067788239 10:49268315-49268337 CTCTGTGGACACCTTGATCTTGG - Intergenic
1068937069 10:62646503-62646525 GACACTGTGCACCTTGATTTTGG + Intronic
1069513921 10:69062592-69062614 CACCCTGTAAACCTTAAAGTAGG + Intergenic
1070915613 10:80152658-80152680 CACACTGTCCACCTTTACCTAGG + Exonic
1072653735 10:97316165-97316187 CTCCCTGTAGGCCTTGATGTGGG + Intergenic
1073514924 10:104067707-104067729 CACACTGTCCACCTTTATCTCGG - Intronic
1077373308 11:2193707-2193729 CACCCTGTACTCCCTGCTCCAGG - Intergenic
1078709328 11:13775788-13775810 CCCCTGGGACACCTTGATCTAGG - Intergenic
1079623923 11:22592613-22592635 CTCCCTGTTCACCCTGATCTTGG - Intergenic
1079666565 11:23113478-23113500 AACACTGTCCACCTTTATCTGGG - Intergenic
1084466959 11:69328952-69328974 CACCATGTCCACCCTGGTCTTGG - Intronic
1086584043 11:88431796-88431818 TACACTGTGCACCTTTATCTTGG + Intergenic
1088129157 11:106466078-106466100 CCCCTTCGACACCTTGATCTTGG + Intergenic
1088617746 11:111648341-111648363 CACCATTGGCACCTTGATCTAGG - Intronic
1091971470 12:4790601-4790623 CAGCCTTTACACCTAGGTCTTGG - Intronic
1092344370 12:7703279-7703301 CATACTGTACACTTTGATTTTGG + Intergenic
1094196078 12:27751503-27751525 TACACTGTCCACCTTTATCTCGG + Intronic
1095914908 12:47468042-47468064 CCCCCTGTCCACCTTGTTCCTGG - Intergenic
1099093293 12:78340274-78340296 TACACTGTCCACCTTTATCTTGG + Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1104151109 12:126084197-126084219 CACACTGTCCACCTTTATCTCGG - Intergenic
1104663718 12:130632556-130632578 CACCCTGTTCTCTTTGCTCTGGG + Intronic
1105812986 13:24010860-24010882 CACCCTGAGCACCTGGTTCTAGG + Intronic
1105813071 13:24011260-24011282 CACCCTGAGCACCTGGTTCTAGG + Intronic
1108530132 13:51320789-51320811 CCCCATCCACACCTTGATCTTGG - Intergenic
1109388523 13:61665115-61665137 CACACTGTCCGCCTTTATCTTGG + Intergenic
1114064962 14:19053085-19053107 GCCCCTGCACACCCTGATCTGGG - Intergenic
1114097299 14:19346917-19346939 GCCCCTGCACACCCTGATCTGGG + Intergenic
1115022414 14:28698463-28698485 CACCCTGCCAACCTTGATCTTGG + Intergenic
1115199788 14:30840634-30840656 CACACTGTCCACCTTTATCTCGG - Intergenic
1116630118 14:47320105-47320127 CCCTGTGGACACCTTGATCTTGG + Intronic
1117554764 14:56872643-56872665 CCCCTTGTACCCCTTGCTCTAGG - Intergenic
1124110410 15:26780193-26780215 CACCCTCTGCACCCAGATCTTGG + Intronic
1125817209 15:42596333-42596355 CACCCTTTGCACCTTAAACTTGG + Intronic
1128688406 15:69704715-69704737 CTGTCTGCACACCTTGATCTTGG - Intergenic
1131512284 15:93056029-93056051 CACCCAGTACAGCCTCATCTGGG - Intronic
1131553764 15:93379481-93379503 CACCCTGCACCCCTGGCTCTAGG - Intergenic
1131994682 15:98122691-98122713 CTCTGTGGACACCTTGATCTTGG - Intergenic
1133034776 16:3028571-3028593 CCCCCTGACCTCCTTGATCTAGG - Intronic
1138088230 16:54153376-54153398 CCCCGTGGACACCTTGATCTTGG + Intergenic
1138503043 16:57460355-57460377 CACCTTGCAAACCTGGATCTTGG + Intronic
1138528049 16:57620189-57620211 CAGCCTGTCCCCCTTGACCTTGG + Intronic
1139614691 16:68081841-68081863 CACCATGTCCACCTTAAACTGGG + Intergenic
1140478208 16:75249466-75249488 CACCCTGCAGCCCTTTATCTGGG + Intronic
1141551173 16:84807653-84807675 CCCCTTCGACACCTTGATCTTGG + Intergenic
1146141718 17:30373931-30373953 CATACTGTCCACCTTTATCTCGG + Intergenic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1146450523 17:32970460-32970482 CACACTGTCCACCTTTTTCTCGG - Intronic
1147659312 17:42108747-42108769 CACACTGTCCACCTTTATCTGGG - Intronic
1149388100 17:56162348-56162370 CCCTCTTGACACCTTGATCTTGG - Intronic
1149628066 17:58094043-58094065 AACACTGTACACCTTTATCTGGG - Exonic
1150650855 17:67009187-67009209 CCCCATCAACACCTTGATCTTGG + Intronic
1151830342 17:76545559-76545581 GACTCTGGACACCTTGCTCTTGG - Intronic
1152134318 17:78494976-78494998 CACCCTGTACACCTTGTGCAAGG - Exonic
1156553110 18:38039485-38039507 CACCCTGAAAAACTTGATCAGGG + Intergenic
1158226037 18:55202531-55202553 CAGACTGTACATCTTTATCTGGG + Intergenic
1160348000 18:78150798-78150820 CACCATCCACACCTTGATTTTGG + Intergenic
1161973714 19:7597179-7597201 CACCCAGAACAGGTTGATCTGGG - Intronic
1162910658 19:13846544-13846566 CACCAGGTACACCTGGATCAAGG + Intergenic
1168477520 19:56687616-56687638 CTCCTTCGACACCTTGATCTTGG - Intergenic
926977992 2:18534093-18534115 CACTGTCGACACCTTGATCTTGG - Intergenic
927138987 2:20117283-20117305 AACCCGAAACACCTTGATCTCGG + Intergenic
929801773 2:45110669-45110691 CATCCTGTACACCCTGACCTCGG + Intergenic
932716872 2:74107143-74107165 CACTCTGTGCACCTGGATGTGGG - Exonic
933773712 2:85759243-85759265 CAGCCTGTACACCATCCTCTCGG + Intronic
935173460 2:100628524-100628546 CACCCTTCACACCTTGAATTTGG - Intergenic
938830450 2:135045086-135045108 CACCCTGTAAACGTTTCTCTGGG + Intronic
938972047 2:136441811-136441833 ACCCCTGTGCACCTAGATCTGGG + Intergenic
947139187 2:227005346-227005368 CAACCTGTTCATCTTGAACTTGG - Exonic
947530953 2:230908310-230908332 CACCCTGTACACCTCCTCCTAGG - Exonic
948443574 2:238014080-238014102 CACCTTCTACACCTGGCTCTGGG - Intronic
1172056521 20:32158107-32158129 CAACCTGGTCACCTTGATCTTGG - Intronic
1173963538 20:47093445-47093467 CACATTGTCCACCTTTATCTCGG + Intronic
1174129844 20:48335689-48335711 CACCCCATACACTTTGAGCTTGG + Intergenic
1177614234 21:23496703-23496725 CATCCTGTTGACCTTGATTTTGG - Intergenic
1178006485 21:28226373-28226395 CACACTGTACACCCAGATCTTGG - Intergenic
1178824156 21:36001570-36001592 ACCCGTGGACACCTTGATCTTGG - Intronic
1180024840 21:45155197-45155219 CACCCTGTTCACCTCTATCCTGG - Intronic
1180143948 21:45909464-45909486 CTCCCTGATCTCCTTGATCTTGG - Exonic
1180483451 22:15775705-15775727 GCCCCTGCACACCCTGATCTGGG - Intergenic
1181149544 22:20873414-20873436 CACACCCTACATCTTGATCTGGG - Intronic
1181484393 22:23221393-23221415 CACCCTGTTCCCCTTCATCAGGG + Intronic
1181856834 22:25787788-25787810 TACCCTTTACCCCGTGATCTGGG + Intronic
1181864739 22:25846264-25846286 CACCATCTGCAGCTTGATCTGGG - Exonic
1184622642 22:45693867-45693889 CCCTCTCGACACCTTGATCTTGG + Intronic
1185418424 22:50721973-50721995 CAGCATGTCCACCTTGAGCTCGG + Intergenic
950841567 3:15973303-15973325 CACCCTGTCTGCCTTTATCTTGG + Intergenic
953320179 3:41964226-41964248 CACACTGTCCACCTTTATCTCGG - Intergenic
958730102 3:97952277-97952299 CAGCCTGGACACATTGATCATGG + Intronic
959718079 3:109455671-109455693 CAGCCTGCACAAGTTGATCTTGG + Intergenic
961535878 3:127570226-127570248 AACAGTGGACACCTTGATCTTGG + Intergenic
961709747 3:128819042-128819064 CCCCGTGGACACCTGGATCTCGG - Intergenic
963518346 3:146335641-146335663 CACACTGTCCACCTTTATCTCGG - Intergenic
963912332 3:150825519-150825541 CACACTGTCCATCTTTATCTTGG + Intergenic
963981499 3:151543350-151543372 TACACTGTCCACCTTTATCTTGG + Intergenic
965167230 3:165210623-165210645 CACACTGTACTCCTTTTTCTGGG + Intergenic
970343261 4:15128743-15128765 CACCAAGTCTACCTTGATCTTGG + Intergenic
970529132 4:16964467-16964489 CCCCGTGGATACCTTGATCTTGG + Intergenic
970838510 4:20439338-20439360 CCCTGTGGACACCTTGATCTTGG - Intronic
971853977 4:32020259-32020281 CACTGTTGACACCTTGATCTTGG - Intergenic
980332632 4:131429006-131429028 CACCCTGATCACCCTGATCATGG + Intergenic
985130304 4:186732472-186732494 CACTGTGGGCACCTTGATCTTGG - Intergenic
986716767 5:10530395-10530417 CCCCGTCCACACCTTGATCTTGG + Intergenic
988739805 5:34059174-34059196 CACCCTGTACACCTTGATCTTGG - Intronic
990373111 5:55141199-55141221 TACACTGTTCACCTTTATCTTGG + Intronic
992859170 5:80894113-80894135 CTCCCTGTGCACAATGATCTGGG - Intergenic
993260061 5:85646819-85646841 CACACTGTCCACTTTTATCTTGG + Intergenic
998045313 5:138982346-138982368 CACCCTGCACACCTTGCTGGTGG - Intronic
1003150430 6:3543328-3543350 CCCCCCTGACACCTTGATCTTGG - Intergenic
1005106915 6:22233607-22233629 CTCCGTTGACACCTTGATCTGGG - Intergenic
1005756911 6:28933156-28933178 AACCCTGCAGACTTTGATCTTGG - Intergenic
1007379813 6:41481251-41481273 CACCTTGTACACCTCCATCAGGG - Intergenic
1007386315 6:41522602-41522624 GACCCTGTAAACCTGCATCTGGG - Intergenic
1009281021 6:61751816-61751838 CACCTTTGACACCTTCATCTTGG - Intronic
1010742535 6:79525848-79525870 CACACTGTCCACCGTTATCTTGG - Intronic
1013000686 6:106019219-106019241 CACTCTGTCCAGCATGATCTTGG - Intergenic
1013645713 6:112138849-112138871 CACCCTGCTCATCTAGATCTTGG + Intronic
1013837621 6:114351056-114351078 CCCCATGTACACATTGATTTTGG + Intergenic
1014988289 6:128040322-128040344 CACCCTGATCACCATCATCTTGG - Intronic
1016887891 6:148975492-148975514 CACACTGGACACTTTGATCATGG - Intronic
1020203509 7:6098347-6098369 CACCCCTCACCCCTTGATCTAGG + Intergenic
1022537591 7:31107498-31107520 AACCCTGTCCATCTTGAGCTGGG - Exonic
1022558576 7:31325616-31325638 CATCTTGTACTCCTTGTTCTTGG + Intergenic
1023082886 7:36542302-36542324 CCCCACGGACACCTTGATCTTGG + Intronic
1028432767 7:90766821-90766843 CACACTGTCCGCCTTTATCTTGG + Intronic
1029737046 7:102470690-102470712 CACCCTTGCCACCTTGTTCTGGG - Intronic
1032787349 7:135211392-135211414 CTCCTTGTCCGCCTTGATCTCGG + Exonic
1033137977 7:138800558-138800580 AACCATCAACACCTTGATCTTGG - Intronic
1035969645 8:4233603-4233625 CAACCAGGACACCTTGATCTTGG + Intronic
1036508505 8:9378925-9378947 CCCTCTTGACACCTTGATCTTGG - Intergenic
1037553689 8:20001501-20001523 CACTGTTAACACCTTGATCTTGG - Intergenic
1038219136 8:25591135-25591157 CACACTGTACACTCTGAGCTTGG + Intergenic
1041077973 8:54186495-54186517 CACCCATGGCACCTTGATCTTGG + Intergenic
1041211391 8:55554730-55554752 CACTGTGGACTCCTTGATCTTGG + Intergenic
1041954609 8:63543609-63543631 GTCCCTGTCCACCTGGATCTTGG + Intergenic
1042053932 8:64742606-64742628 CCCTGTGGACACCTTGATCTTGG - Intronic
1042054009 8:64743492-64743514 CCCTGTGGACACCTTGATCTTGG - Intronic
1043231985 8:77814763-77814785 AACTCTTTAGACCTTGATCTAGG + Intergenic
1046184068 8:110690293-110690315 CACACTGTCTACCTTTATCTTGG + Intergenic
1060817008 9:126640322-126640344 CACCCTGTAGGCCTTGGTATGGG + Intronic
1062199070 9:135291395-135291417 CACACTGTCCACCTTTATCTCGG - Intergenic
1203792487 EBV:159306-159328 CAGCCTGTACACCTTCATCACGG - Intergenic
1185895671 X:3856444-3856466 CACAATGTGTACCTTGATCTAGG + Intergenic
1185900790 X:3894868-3894890 CACAATGTGTACCTTGATCTAGG + Intergenic
1185905905 X:3933307-3933329 CACAATGTGTACCTTGATCTAGG + Intergenic
1186001035 X:5010854-5010876 CTCTGTGGACACCTTGATCTTGG - Intergenic
1198287634 X:135207550-135207572 CACCATTTAGACCTTGATATTGG + Intergenic