ID: 988744044

View in Genome Browser
Species Human (GRCh38)
Location 5:34114791-34114813
Sequence ATGATGTGTTAGAAGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988744044 Original CRISPR ATGATGTGTTAGAAGAGAGA TGG (reversed) Intronic
901779354 1:11583163-11583185 AAGGTGTGTTAGAAGAGAGTTGG - Intergenic
901805032 1:11733205-11733227 ATGAGGTCTTTAAAGAGAGAAGG - Intergenic
903375374 1:22862562-22862584 GTGATGTGGTAGAATAGAGGAGG - Intronic
904095581 1:27974539-27974561 ATGTTGTGCTGGAAGAGAGTGGG + Exonic
904954019 1:34267959-34267981 ATGATTAGTGAGAAGAGAGAAGG - Intergenic
905999582 1:42412825-42412847 TTGATTTTTAAGAAGAGAGATGG - Intronic
906800734 1:48734763-48734785 ATGATGTGGTAGGACAGAGAGGG - Intronic
907155045 1:52325879-52325901 ATGATGTGTTAACTGAAAGATGG + Intronic
909701474 1:78529164-78529186 ATAATGTGTTATAGGAGAGATGG + Intronic
909812433 1:79947060-79947082 TTGATGTGTGATAAGAGAAATGG + Intergenic
910133142 1:83933284-83933306 ATGATGTGGTAGAAGCCAGGAGG + Intronic
911253888 1:95611980-95612002 GTGATGTGGTATGAGAGAGAGGG - Intergenic
911642362 1:100302858-100302880 ACAATGAGTTAGTAGAGAGATGG - Intergenic
911772386 1:101762819-101762841 ATGATGAGTTATAAGAAAGAGGG - Intergenic
912342760 1:108933790-108933812 ATGATGAGGAAGAAGAGAGTTGG - Exonic
913012722 1:114700464-114700486 ATGTTCTGTTAGAGGAGAGAGGG + Intergenic
913419991 1:118655298-118655320 AGGATGGATTAGAAGAGACAGGG + Intergenic
917102072 1:171456193-171456215 TTCATCTGTTAGAAGAGAGTGGG - Intergenic
917174659 1:172220142-172220164 ATGATGTCATTGAAGAGAAAGGG + Intronic
917862122 1:179156354-179156376 AGAATGTGTTAGAAGTAAGAAGG + Intronic
919817442 1:201450522-201450544 ATCCTGTGTTAGAAGAGGTAGGG + Intergenic
920690316 1:208141710-208141732 AATATGTGTGAGTAGAGAGAAGG - Intronic
921474239 1:215586844-215586866 ATGATGTTTTAGAAAAGACATGG + Intronic
921558337 1:216626437-216626459 ATGGTGTGCTAGAAGAGATCTGG - Intronic
922537734 1:226394380-226394402 ATGGTATGTTAGTAGAGAAATGG + Intronic
923152962 1:231250989-231251011 AAGATATTTTAGAAGAGAGGAGG + Exonic
923368593 1:233287710-233287732 ATGACCTGTTAGAAGTGATATGG + Intronic
924297386 1:242601708-242601730 ATGATTTGTTATATGAGATAAGG - Intergenic
1063637869 10:7801175-7801197 ATGAAGTATTAGAAAATAGATGG - Intronic
1064409992 10:15096935-15096957 AAACTGGGTTAGAAGAGAGAGGG + Intronic
1066105385 10:32151914-32151936 ATGCTGTAATAGAAGAGGGAAGG - Intergenic
1066354080 10:34664977-34664999 GTGGTGTGTGTGAAGAGAGAGGG + Intronic
1067037622 10:42931834-42931856 ACAATGTGTTAGACGAGAAAGGG + Intergenic
1068809642 10:61241530-61241552 CTTATGTGGTAGAAGATAGAAGG - Intergenic
1069809389 10:71147154-71147176 TTGAGGTGGTAGAAAAGAGAAGG + Intergenic
1071165673 10:82803396-82803418 ATGATTTATTAGGAGATAGATGG - Intronic
1071286987 10:84158109-84158131 ATGATCTGTTAGTAGAGTTAGGG + Intergenic
1071706287 10:88002774-88002796 ATGAAGTATTAGAAGAGAGATGG + Intergenic
1072380165 10:94859564-94859586 GTGAGGAGTTAGAAGGGAGATGG + Intergenic
1072475009 10:95751544-95751566 ATTTTGTGTTAGGAGAGACAGGG - Intronic
1072619767 10:97072111-97072133 GTGATGGGATAGAACAGAGAGGG + Intronic
1073897767 10:108183260-108183282 ATGATTTTTTTGAAGAGAAAAGG - Intergenic
1075561208 10:123469934-123469956 AGAATGGGTTAGAAGAGAAAAGG + Intergenic
1077892954 11:6432432-6432454 ATGAGGTGGTGGAAGAGTGAGGG + Intronic
1078049911 11:7954678-7954700 TTGAAGTGTGAGAAGAAAGAGGG - Intergenic
1078186309 11:9054649-9054671 AGGATGTGTTGAAAGGGAGAAGG + Intronic
1078856604 11:15210442-15210464 AGGAGTTGTTAGAAGAGAGCTGG + Intronic
1080180903 11:29424952-29424974 ATGATGATATGGAAGAGAGAGGG - Intergenic
1080569834 11:33545683-33545705 AGCAAGTGTTAGAGGAGAGAGGG + Intronic
1080763027 11:35271022-35271044 ATGATGGGTTTGGAGAAAGATGG + Intronic
1080961904 11:37170482-37170504 ATGATGTGTGAGCAGAAACATGG + Intergenic
1081205984 11:40276247-40276269 ATGCTGAGTTAGAATAGGGAAGG + Intronic
1081412031 11:42771003-42771025 ACGAAGTCTTAGAAGAGAAAAGG + Intergenic
1081853405 11:46289510-46289532 GTGCTGTGGTAGAACAGAGAGGG + Intronic
1086003484 11:82007956-82007978 ATTCTGTGTTAAAAGAGAAAAGG - Intergenic
1086462024 11:87015470-87015492 ATGATTTGTTATAAGAATGAGGG + Intergenic
1087439145 11:98160816-98160838 CTGATAAGATAGAAGAGAGAAGG - Intergenic
1088142257 11:106631704-106631726 ATAATGTCTTAGAAGACAAAAGG - Intergenic
1088528159 11:110778911-110778933 ACAATGTGGTAGATGAGAGATGG + Intergenic
1089096110 11:115921386-115921408 ATGATGTGTTAGAAACAAGGGGG - Intergenic
1089595163 11:119574008-119574030 AAGATGTATTTGAAGAGAGATGG - Intergenic
1090069826 11:123534451-123534473 AAGATGTGCAAGAACAGAGATGG + Intronic
1090847538 11:130543609-130543631 AGAATGTATTAGAAGAGAGAAGG + Intergenic
1091811232 12:3399511-3399533 ATGATGTGGTGGAAGGGAGCCGG + Intronic
1092254700 12:6920135-6920157 CTGATGTGTGAGTAGAAAGAAGG + Intronic
1092280161 12:7092276-7092298 ATGAGGTGTGTGAAGAGAGAAGG + Intronic
1092468347 12:8755468-8755490 ATGAGGTATAAGAAAAGAGAGGG - Intronic
1092505900 12:9099669-9099691 ATGATTTATGAGAGGAGAGAGGG - Intronic
1095219746 12:39596073-39596095 ATCGTGTGTTAGAGGAGAGTAGG + Intronic
1096732230 12:53623223-53623245 ATGATGTGTTAAAAGACGGTTGG - Intronic
1096830548 12:54310526-54310548 TGGAGATGTTAGAAGAGAGAAGG - Intronic
1096910944 12:54983395-54983417 ATGAAGTGTTAGTAGGAAGAAGG - Intronic
1097769706 12:63569241-63569263 ATTATGTTTTAGAAGAGGCATGG - Exonic
1099001797 12:77187066-77187088 AAGATGTGTTAGAACAGATAAGG - Intergenic
1099204109 12:79708829-79708851 AAGATGGGTTAGAGGAGACACGG + Intergenic
1099849560 12:88074887-88074909 GAGATGTGTAAGAAGAGATATGG - Intronic
1101719375 12:107337930-107337952 ATGAAGAATTAGAAGAGAGATGG - Intronic
1101975448 12:109354132-109354154 ATGATTTGTGATAAGACAGATGG - Intronic
1102227295 12:111237748-111237770 ATGACGGGTGAGAAGAGGGAAGG - Intronic
1102891504 12:116561968-116561990 ATGAGGGGGTGGAAGAGAGATGG - Intergenic
1105003173 12:132704207-132704229 GTGATGGGTTAGAGGAGGGAAGG + Intronic
1109404777 13:61883170-61883192 ATGATGAGTGAGGAGAGAGTTGG + Intergenic
1109759824 13:66813194-66813216 ATGATGTAATGGAACAGAGATGG + Intronic
1110427993 13:75391138-75391160 CTGATGTTGTAGAAGAGAGAGGG - Intronic
1110481031 13:75976445-75976467 ATGATGAGGTAGAAAATAGAAGG + Intergenic
1110695851 13:78487530-78487552 AGGATGTGTTAGAAAAGGGCAGG - Intergenic
1111290549 13:86163141-86163163 ATGTTGTGGTAGAAGAGCCAGGG + Intergenic
1111340066 13:86872603-86872625 ATCATGTGTTACAATATAGAAGG + Intergenic
1111374189 13:87355968-87355990 TGCATGTGTTAGAAGAGAGGTGG - Intergenic
1111599038 13:90447852-90447874 AGGCTGAGTTAGAAGACAGAAGG - Intergenic
1111742490 13:92221391-92221413 ATGATTGCTGAGAAGAGAGAGGG - Intronic
1114299519 14:21361933-21361955 ATTATTTTTTAGAAGAGACAAGG + Intronic
1115370136 14:32603801-32603823 ATAATGTTTTAGAAGAGAATTGG + Intronic
1115571601 14:34671879-34671901 ATAATGTGGCAGGAGAGAGAAGG + Intergenic
1116297532 14:43132544-43132566 ATGATGTGGCAGAGGAGAGGTGG + Intergenic
1117658827 14:57983721-57983743 ATGATGTGATATAAGTGATATGG - Intergenic
1119019556 14:71096819-71096841 AAGAAGTGTTAGAAGGCAGATGG + Intronic
1120741347 14:88112028-88112050 AGGATGTATCAGAAGATAGAGGG - Intergenic
1120849865 14:89160100-89160122 ATGATGCGTGAGGAGAGGGAGGG - Exonic
1121568379 14:94927661-94927683 ATGAAGTGTTAGAAGAAGGTAGG - Intergenic
1121840642 14:97130940-97130962 CTCATGTGTTAAAAGGGAGAAGG + Intergenic
1122373176 14:101240591-101240613 ATGATGGGTTGGAAGAGAATTGG + Intergenic
1124663801 15:31574021-31574043 ATTAGATGGTAGAAGAGAGAGGG + Intronic
1125470909 15:40002561-40002583 CTGATGTGTTCAAAGAGGGATGG + Intronic
1125639901 15:41221925-41221947 TTGATGTTTTAGTAGAGACAGGG - Intronic
1125693128 15:41612802-41612824 ATGATGTGGTGGAATAAAGATGG - Intergenic
1125811295 15:42543656-42543678 ATGAAGTGTTAACACAGAGATGG + Exonic
1125814388 15:42572044-42572066 ATGATTGATTAGAACAGAGATGG + Intergenic
1126243949 15:46481327-46481349 AAGAAGTGTTAGAAAAAAGAGGG - Intergenic
1126835420 15:52659090-52659112 ATGATGTTTTAGAAGAGCTGGGG - Intronic
1127338140 15:58010774-58010796 ATGGTCTGTTGGAAGAGAAATGG + Exonic
1129228128 15:74181609-74181631 ATGGTGGGTTGAAAGAGAGAAGG - Intronic
1130025387 15:80266702-80266724 AGGTTGTGTTAGAACAAAGATGG - Intergenic
1130890408 15:88128616-88128638 ATGATGTGGAATAGGAGAGAGGG + Intronic
1131040255 15:89258009-89258031 AAGATGAGTTTGAAGAGAAACGG - Intronic
1132390445 15:101434634-101434656 CAGGTGTGTTAGCAGAGAGAGGG - Intronic
1132823550 16:1890452-1890474 CTAATGTTTTAGAAGAGTGATGG - Intergenic
1133462574 16:6000062-6000084 GTGATTTGTCGGAAGAGAGAAGG + Intergenic
1134631642 16:15760319-15760341 ATGATGGGTGAGCAGATAGATGG + Intronic
1134862271 16:17571102-17571124 ATGATGTCTTTGAGAAGAGAAGG - Intergenic
1136004906 16:27322736-27322758 AGTAAGTATTAGAAGAGAGAAGG - Intronic
1136452747 16:30363168-30363190 ATGCAGTGTGAGAGGAGAGAGGG - Intronic
1137408250 16:48207023-48207045 CTGATGTGTTAAGAGAGAGCTGG + Intronic
1138852486 16:60645539-60645561 TTTATGTTTTAGAAGAGATAAGG - Intergenic
1139225106 16:65227198-65227220 ATGCAGTGTTAGAACAAAGAGGG - Intergenic
1140558916 16:75954559-75954581 CAGATGTTTTAGAAGAGAGCTGG + Intergenic
1140560962 16:75981149-75981171 TTGATGTGTAAGCACAGAGAAGG - Intergenic
1141075482 16:81002987-81003009 AATATGTGGTAGAAGAAAGAAGG - Intronic
1142181827 16:88674909-88674931 AGGATGGGTTGGCAGAGAGAGGG - Intergenic
1146259824 17:31414071-31414093 ATCATGTGTTAGGACTGAGAGGG - Intronic
1146386712 17:32383442-32383464 AAAACGTGTTAGAAAAGAGATGG + Intergenic
1146960182 17:36968161-36968183 GAAATGTCTTAGAAGAGAGAGGG - Intronic
1149560937 17:57607560-57607582 ATGATGTCTGAGAAGGGAGGAGG + Intronic
1150943841 17:69723226-69723248 ATCAAGTATTAAAAGAGAGATGG - Intergenic
1151004221 17:70415079-70415101 ATGAGGTGGTAGAATAAAGAAGG + Intergenic
1151319873 17:73346586-73346608 GTGATGGGCTAGAGGAGAGAGGG - Intronic
1152250061 17:79207827-79207849 AGGATGAGCAAGAAGAGAGAAGG - Intronic
1153120841 18:1724930-1724952 ATGATATCTTATAATAGAGAAGG + Intergenic
1153368439 18:4286200-4286222 ATTATATGGTAGAGGAGAGATGG + Intronic
1156140460 18:34102607-34102629 ATGATTTTTTAGAAGCCAGAAGG + Intronic
1156699231 18:39805206-39805228 ATAATCTGTTTCAAGAGAGATGG - Intergenic
1156864050 18:41868977-41868999 ATGGTGTATTAGAAGAGACTGGG + Intergenic
1158435372 18:57431641-57431663 ATGATGTGTTTGATAAGGGAGGG + Intergenic
1161510156 19:4665940-4665962 ATGGTGTGTTAGCAGACAGGAGG - Intronic
1162488977 19:10980440-10980462 ATGATTTGATGGAAGGGAGAGGG + Intronic
1163836173 19:19575667-19575689 ATGATGTGTTTGAAAAGGGTTGG - Intronic
1165188071 19:34039195-34039217 AAGATGTTTTTGAAGAGACAGGG + Intergenic
1165817875 19:38653847-38653869 CTGACCTGTTACAAGAGAGACGG + Intronic
1166344596 19:42157322-42157344 ATGCTGGGTTAGGGGAGAGAGGG - Intronic
1168046262 19:53796419-53796441 TTGTTGTATTAGTAGAGAGAGGG + Intronic
927879512 2:26680816-26680838 CTGAGGTGTAAGCAGAGAGAGGG + Intergenic
929823293 2:45290492-45290514 ATGACCTGCTAGATGAGAGAGGG + Intergenic
930840811 2:55842816-55842838 ATGATGAGGAAGAAGAGATAGGG + Intergenic
934161581 2:89254499-89254521 ATGATGAGGTATAAGAAAGATGG + Intergenic
934205703 2:89927916-89927938 ATGATGAGGTATAAGAAAGATGG - Intergenic
936400869 2:112163561-112163583 CTGATGTGGTTGGAGAGAGACGG - Intronic
939114314 2:138043023-138043045 CTGAAGTGTGAGAAGAGAGGAGG + Intergenic
939568708 2:143814836-143814858 TTGATGACTAAGAAGAGAGAGGG + Intergenic
940022534 2:149170395-149170417 GTGACGTGATAGAAGACAGATGG - Intronic
940412950 2:153387773-153387795 ATGATTTTTTGGAAGTGAGATGG + Intergenic
941255639 2:163228058-163228080 ATGATAAGTTAGAAGGCAGAAGG + Intergenic
941316256 2:163996225-163996247 ATAATGTGCAAGAAGAGAGACGG + Intergenic
942105843 2:172632673-172632695 ATGATGCATTAGAACATAGATGG + Intergenic
944119328 2:196224089-196224111 ATGATGGGGTAGAGTAGAGATGG + Intronic
945685205 2:212960484-212960506 ACAATGTGTTAGAATAGAAACGG + Intergenic
945735440 2:213593650-213593672 ATGATGACCTAGAAAAGAGAAGG - Intronic
946505758 2:220299049-220299071 AGGATGGGTTAGAGTAGAGAAGG + Intergenic
946906474 2:224421747-224421769 TTGATGTGAGAGATGAGAGAAGG + Intergenic
947075306 2:226337217-226337239 ATGATGAGAAAGAAGAGGGAAGG - Intergenic
947477798 2:230466835-230466857 ATGTGGTGTAAGAAGACAGAGGG + Intronic
948193936 2:236081026-236081048 ATAATGTGGTAGAAGGGAAATGG - Intronic
948760703 2:240189106-240189128 ATGATTTCTTAAAAGAGAAATGG + Intergenic
1168884953 20:1242765-1242787 ATGATGTGGAAGAAGAGGGGAGG + Exonic
1168953523 20:1818548-1818570 GAGATGTGTAAGAATAGAGAGGG - Intergenic
1169392908 20:5204668-5204690 ATGAGGTGTAAGAAGACAGAAGG - Intergenic
1170795310 20:19541818-19541840 AGAATGTGTGAGAGGAGAGATGG - Intronic
1172429994 20:34882314-34882336 AAGATGGGTTAGAAGAGTGTTGG + Intronic
1174004441 20:47399252-47399274 GTGATGTGTTAAATGAGAAAAGG + Intergenic
1177672487 21:24251200-24251222 ATGATGTTTTATGAGAGACATGG + Intergenic
1177809327 21:25908543-25908565 AGACGGTGTTAGAAGAGAGACGG + Intronic
1178160310 21:29904792-29904814 TTGATCTGTTAGAACAGAGCTGG - Intronic
1180786553 22:18550896-18550918 AAGATGTCTGAGCAGAGAGAAGG + Intergenic
1181243473 22:21490449-21490471 AAGATGTCTGAGCAGAGAGAAGG + Intergenic
1182680546 22:32076040-32076062 GTGATGGGTGAGAAGAGAGGAGG + Intronic
1183148559 22:36018256-36018278 ATGATGTCTTGGAAGACAGCAGG + Intronic
949094077 3:65111-65133 ATGATAGGTTAGAAGAAAAAGGG + Intergenic
949655278 3:6210708-6210730 ATGCTATTTTAGAAGAAAGATGG + Intergenic
949702824 3:6779188-6779210 ATGAAGAGTAAGAGGAGAGAGGG + Intronic
950295643 3:11827743-11827765 ATTATGGGTGAGAAGAGAGTAGG - Intronic
952530713 3:34259228-34259250 AGGATTTGTTAGAACACAGATGG + Intergenic
953070016 3:39510730-39510752 ATGTTGTCTTTGAATAGAGACGG + Intronic
953116067 3:39993593-39993615 ATGATGATTGAGGAGAGAGAAGG - Intronic
953620888 3:44531824-44531846 CTGATGTTTTAGATGTGAGAGGG - Intergenic
954457915 3:50610000-50610022 ATGATTTGTTAGAACCTAGAGGG - Intronic
954911098 3:54110639-54110661 ATGATGAGTGAGAAGAGGGAAGG - Intergenic
955088857 3:55729659-55729681 ATTATTTTTTAGAAGAGACAAGG - Intronic
955780832 3:62482907-62482929 CTGACGTGATGGAAGAGAGATGG + Intronic
955901345 3:63759261-63759283 ATAATCTCTTAGAAGAGAAATGG + Intergenic
959652877 3:108768959-108768981 AGGATGTGTTAGCAAATAGAAGG + Intergenic
959734521 3:109642792-109642814 ATCATATGTTAGGGGAGAGATGG + Intergenic
959779957 3:110219131-110219153 ATTATGGGACAGAAGAGAGAAGG - Intergenic
960175570 3:114513801-114513823 ATGAAGTGCTAGAAGATGGAAGG - Intronic
960301548 3:116008936-116008958 AAGAAGTGGTAGAAGAGACAAGG - Intronic
962020095 3:131490990-131491012 AAGATTTCTTAGAAGAGAGTGGG - Intronic
962711968 3:138094931-138094953 AAGAGGTGTTAGAAGAGCTACGG - Exonic
962773362 3:138634447-138634469 AAAAGGTGTTAGAAGAAAGAAGG - Intergenic
962967276 3:140366575-140366597 TTGCTGGGGTAGAAGAGAGAGGG - Intronic
963772389 3:149401190-149401212 ATGATATATTAGGAGAGAAAAGG - Intergenic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
964352318 3:155815406-155815428 ATGATGTGTGACAAGACACATGG - Intergenic
967117433 3:186354643-186354665 ATGATGTGTAAGAGAAAAGAAGG - Intronic
971030216 4:22628389-22628411 ATTAACTCTTAGAAGAGAGATGG - Intergenic
972067942 4:34974949-34974971 ATGATGTCACTGAAGAGAGATGG - Intergenic
972839931 4:42918657-42918679 CTCATGTGTCAAAAGAGAGATGG - Intronic
973122229 4:46535802-46535824 AAGCTGAGTAAGAAGAGAGAGGG - Intergenic
973813730 4:54598693-54598715 TTGTTATGGTAGAAGAGAGAAGG + Intergenic
973860947 4:55064019-55064041 CTGATTTTTTAGAAAAGAGATGG - Intergenic
973898249 4:55438533-55438555 AAAATCTGTTAGAAGAAAGAAGG + Exonic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
975656049 4:76642190-76642212 ATGATCCATTAGAAGAGATAGGG - Intronic
975937403 4:79598723-79598745 ATGAACTGTTAGTGGAGAGAAGG - Intergenic
975957413 4:79857875-79857897 CTGATGTGTGAGGATAGAGAAGG - Intergenic
977960629 4:103081068-103081090 GTAATGTGTGAGAAGAGGGAAGG - Intronic
978589692 4:110311592-110311614 TGGATGTGGTAAAAGAGAGATGG - Intergenic
981029651 4:140111623-140111645 ATGATTTGATAGAATAGAGCTGG + Intronic
981784027 4:148457411-148457433 AGAATGTGTAAGAAGAGTGATGG + Intergenic
982304659 4:153917961-153917983 ATGAGGTGTTAGCGCAGAGAAGG - Intergenic
982582497 4:157196393-157196415 TTTATGTGTTACAAGAGAAATGG + Intergenic
982652946 4:158109475-158109497 ATGTTGTGTTAGTAGAGACTGGG - Intergenic
984322938 4:178216418-178216440 AGGATTCGTTAGAAAAGAGAAGG + Intergenic
985073818 4:186192653-186192675 ATCATGTTTTAAAACAGAGATGG + Intronic
985268467 4:188172374-188172396 ATGATCTGTTATACGAAAGAAGG - Intergenic
985302264 4:188503380-188503402 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302371 4:188504229-188504251 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302454 4:188504955-188504977 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302656 4:188506526-188506548 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302755 4:188507313-188507335 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302771 4:188507434-188507456 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985393445 4:189515500-189515522 ATGAAAGGTTAGAAGACAGAAGG - Intergenic
986529934 5:8726080-8726102 CTTATATGTTAGAAGAGAGATGG + Intergenic
986733874 5:10653993-10654015 CTAATGAGTTAGAAGAGACAAGG - Intergenic
987042507 5:14076243-14076265 TGGATTAGTTAGAAGAGAGAGGG + Intergenic
987081478 5:14429089-14429111 ATGATGTGTTGGGTAAGAGATGG + Intronic
987651515 5:20746673-20746695 ATGACATGTTAGAAGAGAGATGG + Intergenic
987758445 5:22127158-22127180 ATGAGCTATAAGAAGAGAGAAGG + Intronic
988153040 5:27412138-27412160 ATGATGTTTGAGAAGAGAACAGG - Intergenic
988683762 5:33507873-33507895 ATAATGTAGAAGAAGAGAGAAGG - Intergenic
988734455 5:34007117-34007139 ATGCTGTTTTAGAAGGAAGAAGG + Intronic
988744044 5:34114791-34114813 ATGATGTGTTAGAAGAGAGATGG - Intronic
989585623 5:43072083-43072105 ATGATATTTTAGAAGATAAATGG + Intronic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990799704 5:59586801-59586823 AAGAAGTGTTAGAAGGGAAATGG + Intronic
991571623 5:68060530-68060552 AGGATTTGCCAGAAGAGAGAAGG - Intergenic
991749202 5:69781295-69781317 ATGAGCTATAAGAAGAGAGAAGG + Intergenic
991800783 5:70361106-70361128 ATGAGCTATAAGAAGAGAGAAGG + Intergenic
991827817 5:70648935-70648957 ATGAGCTATAAGAAGAGAGAAGG - Intergenic
991893146 5:71360547-71360569 ATGAGCTATAAGAAGAGAGAAGG + Intergenic
992787524 5:80184244-80184266 CTGATGGAGTAGAAGAGAGAAGG - Intronic
993171216 5:84421456-84421478 ATGCTGTGTGAGAAGAGACGAGG + Intergenic
993942416 5:94075866-94075888 GTGATGTGCTATAAGAGAAAGGG + Intronic
994999408 5:107107949-107107971 ATGATGTTTCAGGAGAGACAGGG - Intergenic
995621404 5:114029992-114030014 ATTTTGTGTTAAAAGAGAGATGG + Intergenic
997025472 5:130055510-130055532 ATGATATGTTAGAAGAGACATGG + Intronic
998426143 5:142030369-142030391 ATGAGGGGTTAGGAGAGAAAGGG + Intergenic
999090735 5:148933729-148933751 AAGAGGTGAAAGAAGAGAGAGGG - Intronic
1000688712 5:164287604-164287626 AAAATGAGGTAGAAGAGAGAAGG - Intergenic
1002128783 5:177066444-177066466 ATGAGGTGTATGAGGAGAGATGG + Intronic
1003543841 6:7041749-7041771 ATCAGGAGGTAGAAGAGAGAGGG + Intergenic
1004564568 6:16783927-16783949 ATAATGTTTTAAAAGATAGATGG - Intergenic
1006067078 6:31469899-31469921 TGGATGTGTGAGCAGAGAGAAGG + Intergenic
1006082634 6:31576225-31576247 GTGGGGTGTGAGAAGAGAGATGG + Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1007821671 6:44564999-44565021 ATGATGAGTTAGAAGACTGGTGG + Intergenic
1007909540 6:45499858-45499880 ATGATGTGTTGGAAAAGAATAGG - Intronic
1009931171 6:70179069-70179091 AAGATGTGTTAGAGCTGAGAAGG - Intronic
1010142365 6:72625929-72625951 ATGATGTTAGAGCAGAGAGAAGG - Intronic
1010308862 6:74359305-74359327 GTGTTGTGAGAGAAGAGAGAAGG + Intergenic
1011338805 6:86289124-86289146 AACAAGTATTAGAAGAGAGATGG + Intergenic
1012499843 6:99876185-99876207 ATATTGTGTTGGAAGAGAGTTGG + Intergenic
1012858184 6:104527868-104527890 AGGCTGTGTTATAGGAGAGATGG + Intergenic
1012939433 6:105402148-105402170 AGGAGGTCTTAGAAGGGAGAGGG - Intronic
1014866262 6:126534049-126534071 ATGATGTATGAGAAAGGAGAGGG + Intergenic
1015517537 6:134098991-134099013 TTGAGGAGTTAGAAGAGAGAAGG - Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1017682715 6:156880212-156880234 AGGATGTGATAAGAGAGAGAAGG + Intronic
1020362346 7:7340984-7341006 AGAATGTGGTAGAAAAGAGAAGG - Intergenic
1020991651 7:15204619-15204641 ATGATGTGTTAGCACAAGGACGG - Intronic
1021592763 7:22281756-22281778 CAGATGTGTTAGAATAGCGAAGG - Intronic
1022367201 7:29733539-29733561 ATTATGTTTTAGAAGAGGCATGG + Intergenic
1022928979 7:35090337-35090359 ATTATGTTTTAGAAGAGGCATGG - Intergenic
1024686465 7:51751166-51751188 ATGATGGGTGAGAGGAGGGAGGG - Intergenic
1024713919 7:52052804-52052826 AGGATCTGTTAGTAGAGTGAGGG + Intergenic
1027865841 7:83645608-83645630 ATATTCAGTTAGAAGAGAGAGGG + Intronic
1027936306 7:84608002-84608024 ATGAAGTGCTAGGGGAGAGAGGG - Intergenic
1027965334 7:84998592-84998614 GGGATTTGTTAGAAGACAGAAGG - Exonic
1028311973 7:89349860-89349882 AAGAAGTGTCAGAAGAAAGAGGG - Intergenic
1028936215 7:96466620-96466642 ATGATGATATACAAGAGAGAAGG - Intergenic
1029825089 7:103184019-103184041 ATTATGTTTTAGAAGAGGCATGG - Intergenic
1030171341 7:106605975-106605997 ATGAAGAGTTAGCACAGAGAGGG - Intergenic
1030367869 7:108666866-108666888 ATGAGGTGATAGAAGGGAAAAGG - Intergenic
1031963315 7:128008937-128008959 ATGGTGTGGTAGAGTAGAGAAGG + Intronic
1032247766 7:130227548-130227570 ATTATGTGTGATAAGAGAAAAGG + Intergenic
1033512614 7:142074701-142074723 ATGTTCTGGTAGAAAAGAGAAGG + Intronic
1034002927 7:147436259-147436281 TTGATGTTTTTCAAGAGAGAAGG - Intronic
1035907804 8:3532395-3532417 ATGGTGAGCTAGAAGAAAGATGG + Intronic
1035925705 8:3725590-3725612 CTGATGGCTTAGGAGAGAGAAGG + Intronic
1036067071 8:5392620-5392642 AAGCAGTGTAAGAAGAGAGATGG + Intergenic
1036155863 8:6341341-6341363 AAGAGGTGGTAGAAGGGAGAAGG - Intergenic
1036809581 8:11858201-11858223 TAGAAGTGTTAGAGGAGAGAGGG - Intronic
1038769873 8:30467482-30467504 ATGGTCTGTCAGAAGAGGGATGG + Intronic
1038906972 8:31915865-31915887 ATAATTTCTTACAAGAGAGAAGG - Intronic
1039707641 8:40023608-40023630 TTTATGGGTTAGAAAAGAGAGGG - Intergenic
1039786603 8:40839796-40839818 ATGAAGTCTTGGAAGAGTGAGGG + Intronic
1039970448 8:42317594-42317616 ATTATCAGTTAGAAAAGAGAGGG + Intronic
1041053734 8:53961482-53961504 ATTATGTGTGGGAAGAGAAAAGG - Intergenic
1041483328 8:58346834-58346856 TTGATGTGGGAGAAGACAGATGG + Intergenic
1041539753 8:58970324-58970346 ATGATGGGTAAGCATAGAGATGG - Intronic
1042272506 8:66969554-66969576 ATGCAGTCTTAGGAGAGAGAAGG - Intronic
1042525630 8:69761869-69761891 ATGATGGCTGAGAAGACAGAAGG + Exonic
1042641277 8:70937960-70937982 ATGATGGGTTAGACCACAGAGGG + Intergenic
1043073657 8:75668519-75668541 AATATGTGATAAAAGAGAGATGG + Intergenic
1043356733 8:79422546-79422568 ATGATATGTTAGAAGATTCATGG - Intergenic
1044428256 8:92079636-92079658 ATGAGTAGTTAGAAGAGAGAAGG - Intronic
1046154438 8:110268934-110268956 AAAATGTATTAGAAGAGAAAGGG + Intergenic
1046228505 8:111319463-111319485 ATTATATATTATAAGAGAGAAGG + Intergenic
1046661403 8:116951473-116951495 CGGATGTGCTACAAGAGAGAAGG - Intronic
1046661460 8:116952011-116952033 TGGATGTGGTACAAGAGAGAAGG + Intronic
1048653281 8:136505244-136505266 ATGATGTGTTAAACAATAGATGG + Intergenic
1050746212 9:8879196-8879218 AAGATCTGTTAGCTGAGAGATGG + Intronic
1050750100 9:8927172-8927194 AGCATGTCTTAGAAAAGAGAAGG - Intronic
1052921231 9:33971252-33971274 ATAATGTGGTAGATGATAGATGG - Intronic
1053379274 9:37635888-37635910 AGGAGGTGTTAGCAGTGAGAGGG + Intronic
1054754011 9:68938834-68938856 ATTCTGTGTTTGAAGACAGAGGG - Intronic
1055184217 9:73431189-73431211 ATGAAATGTTGGTAGAGAGATGG - Intergenic
1055617678 9:78090114-78090136 CTGATGTCATAGAAGAGTGATGG + Intergenic
1056234004 9:84573722-84573744 AGAATGTGTTAGAAGTGAGATGG + Intergenic
1056399939 9:86216784-86216806 ATGCTATTTTAAAAGAGAGAAGG + Intergenic
1058619014 9:106863751-106863773 AAGATGAGTGAGAAGAGAGCTGG + Intronic
1060517550 9:124275525-124275547 GTGATGTCTGAGAAGTGAGAAGG - Intronic
1060676389 9:125519125-125519147 ATGATGTGTGAGGAGCCAGATGG - Intronic
1187203078 X:17154658-17154680 ATGGTTTGATAAAAGAGAGATGG + Intergenic
1187235770 X:17465675-17465697 ATGATGTGTTCCCAGAGAAAGGG - Intronic
1187630355 X:21162620-21162642 ATGATCTGTTATCTGAGAGAGGG + Intergenic
1188305573 X:28557249-28557271 ATGTGGTGGCAGAAGAGAGAGGG + Intergenic
1188308388 X:28586680-28586702 AAGATGGATTACAAGAGAGAAGG - Intergenic
1189265399 X:39712022-39712044 AAGTTGTGTTAGCAGAGAAAGGG - Intergenic
1190117078 X:47632796-47632818 AGGATGCGTGAGAAGAGAGAAGG + Intergenic
1191044955 X:56126367-56126389 ATGATATTCTAAAAGAGAGATGG - Intergenic
1192396791 X:70790246-70790268 AAGATGTGTTTGAAGTGTGATGG - Intronic
1192867629 X:75152345-75152367 CTCATGTGGTAGAAGAGACAAGG - Intronic
1193998486 X:88396559-88396581 ATGATGTCTATGAAGAGACATGG - Intergenic
1194224174 X:91234561-91234583 ATGATGTGTGAGAAATGAGTAGG - Intergenic
1195408890 X:104547563-104547585 TTGAAGGGTTAGAAGAGAGGAGG + Intergenic
1195492073 X:105482482-105482504 ATGATGTGTTGGAAAAATGAAGG + Intronic
1196100646 X:111844022-111844044 ATGATGTGTTTCATGAGGGAAGG + Intronic
1197712295 X:129679962-129679984 ATGAAGTGTTTGAAGCCAGATGG - Intergenic
1198058766 X:133022329-133022351 ATGTTGTGTTACAAGACATATGG + Intergenic
1198602364 X:138297175-138297197 ATGGTGTGTTAGGAGAGAACTGG + Intergenic
1200040895 X:153367442-153367464 AAAATATGTTGGAAGAGAGAAGG - Intergenic
1200560636 Y:4697928-4697950 ATGATGTGTGAGAAATGAGTAGG - Intergenic
1200714909 Y:6527222-6527244 ATCATGTAGTAGAAGAGAGAAGG - Intergenic
1201018913 Y:9633909-9633931 ATCACGTAGTAGAAGAGAGAAGG + Intergenic